Аргинин акг: AAKG (Arginine AKG) Capsules 120 (Be First) PitProfi

Содержание

AAKG что это такое и для чего оно нужно

Многие спортсмены, использующие спортивное питание, знакомы с такой биологической добавкой как аминокислота аргинин. Аргинин является донатором азота, в спортивном питании используется для скорейшего восстановления после усиленных тренировок, при травмах, способствует питанию мышц, стимулирует выработку гормона роста. Аргинин необходим для синтеза оксида азота, который регулирует тонус сосудов, способствует их расслаблению, повышает противотромбозные свойства сосудистой системы.

В настоящее время разработана новая форма аргинина, это AAKG (или ААКГ) - аргинин альфа-кетоглутарат, точнее соль аминокислоты аргинина и альфа-кетоглутаровой кислоты. Эта комбинация солей усиливает эффект аргинина, поэтому получила широкое применение в спортивном питании и бодибилдинге. Для чего же необходима добавка ААКG?

Аргинин альфа-кетоглутарат в бодибилдинге употребляется для повышения эффекта пампинга - наполненности мышечной ткани, способности к многократным повторениям во время тренировок. Расслабляя ткань кровеносных сосудов, аргинин способствует улучшению кровеносного питания тканей тела, в том числе и мышц, лучшему снабжению кислородом, а значит и приводит к ощущению наполненности мышечной ткани, ускорению ее роста, увеличению силовых показателей, ускорению синтеза белка.

AAKG помогает при физической нагрузке

Биодобавка AAKG способствует выведению молочной кислоты после повышенной мышечной нагрузки, ускоряет восстановление после тренировки или иной активной физической нагрузки.

Аргинин альфа-кетоглутарат способствует оздоровлению всего организма, обеспечивая выведение шлаков - продуктов распада белков, а значит необходим и для детоксикации печени.

Прием добавок аргинина способствует сжиганию подкожного жира, а также стимулирует выработку гормона роста, при этом соответственно наращивается мышечная масса.

Аргинин альфа-кетоглутарат применяется для снижения кровяного давления, а также для выведения из организма "плохого" холестерина, защищая нас от развития такого неприятного заболевания как атеросклероз.

AAKG активизирует синтез коллагена - белка, отвечающего за красоту и гладкость нашей кожи, состояние ногтей, волос.

Также аргинин альфа-кетоглутарат стимулирует повышение иммунитета, снижает вероятность развития различных злокачественных новообразований и инфекций.

Аргинин, а также добавки с ним способствуют улучшению эректильной функции у мужчин за счет повышения снабжения кислородом тканей организма, в том числе и половых органов, применяются при бесплодии.

Аргинин входящий в состав добавки аргинин альфа-кетоглутарата необходим организму для синтеза креатина- белка отвечающего за рост мышечной массы, наполненности мышц, выполняющего энергетическую функцию в организме.

Хотя некоторые исследования показывают, что особого эффекта в бодибилдинге применение AAKG не вызывает, многие спортсмены использующие эту добавку говорят об обратном.

Как принимать аргинин альфа-кетоглутарат, дозировки

Для лучшего питания мышц, увеличения пампинга рекомендуется принимать аргинин альфа-кетоглутарат за полчаса до начала тренировки, затем сразу после окончания тренировки. В остальные дни, когда тренировки отсутствуют, принимают аргинин альфа-кетоглутарат утром после сна и вечером перед сном. Такая схема будет стимулировать синтез гормона роста, повышение иммунитета. Разовый прием составляет 4-5 грамм, суточный - 8-10 грамм. Увеличение суточной порции нежелательно, так как может привести к повышенным нагрузкам на организм при отсутствии заметных положительных эффектов. Курс приема биодобавки - не более 2х месяцев. Выпускается аргинин альфа-кетоглутарат в различных формах: порошок, желатиновые капсулы, питьевые ампулы.

При передозировках препарата возможно появление тошноты, рвоты, диареи, слабости, падение артериального давления.

Хотя прием аргинин альфа-кетоглутарата в рекомендованных количествах считается безопасным, от этой добавки следует отказаться при наличии заболеваний герпеса, при шизофрении, в период беременности и грудного вскармливания, а также при непереносимости компонентов препарата. Во время течения воспалительных заболеваний также прием аргинин альфа-кетоглутарата следует ограничить.

ARGININE AKG 1000 MG CAPS

ARGININE AKG 1000 MG CAPS
продукт подробная информация Питательная Ценность

Обращайте особое внимание на описание на этикетках продуктов! В одной капсуле EXTRIFIT® ARGININE содержится 1000 мг Альфа-кетоглутарата Аргинина (Arginine AKG), который считается еще более действенной формой аргинина.

Общая информация о продуктах с аргинином компании EXTRIFIT®:

 Как действуют аргинины? 

Нет ничего более безотрадного, чем вялый, скучный тренинг без ощущения полных, налитых мускулов... И все же кровенаполнение это не просто приятное ощущение накачанных на тренировке мышц! Хотя этому чувству нет цены, не правда ли?

Кровоснабжение и накачка мышечных волокон чрезвычайно важны. И помимо того, что это дает приятное ощущение твердости тренируемой мускулатуры, мышцы в этом усиленном кровотоке получают важные питательные вещества, благодаря которым они восстанавливаются, крепнут и растут! Поэтому не забудьте также вместе с Аргинином AKG принять до, во время и после тренировки, например, AMINOGEL, HYDRO, BCAA, AMINOFREE, GLUTA.

.., т. е. вещества, необходимые для роста мышц! Недостаточно улучшить кровообращение мышц с помощью силы Аргинина AKG — их также нужно питать! Extrifit, естественно, имеет все эти вещества роста в предложении, а также много других.

Аргинин AKG является основой добавок для накачки мышц кровью. Он является составной частью подавляющего большинства так называемых Preworkout (предтренировочных) продуктов. Теперь вы можете дозировать аргинин самостоятельно соответственно личным потребностям. Вы можете повысить свою предтренировочную подготовку (NO-продукты) с помощью дополнительных граммов аргинина. ARGININE AKG 1000 MG/CPS — это идеальная добавка для кровоснабжения также для вечерней тренировки, когда NO-продукты с содержанием кофеина являются неподходящими (стимулирующий эффект кофеина может помешать засыпанию и нарушить сон).

 EXTRIFIT®  ARGININE AKG 1000 M G/CPS СОДЕРЖИТ 1000 мг АРГИНИНА AKG В КАЖДОЙ КАПСУЛЕ!

ИДЕАЛЬНО ПРОСТАЯ ДОЗИРОВКА: ОДНА КАПСУЛА — ЭТО ОДИН ГРАММ АРГИНИНА AKG!

На каждой капсуле стоит печать с логотипом EXTRIFIT® — знаком оригинальности, подтверждающим, что они были изготовлены на нашей фабрике. В капсулах с оригинальной печатью EXTRIFIT® будут постепенно выпускаться все наши капсулированные продукты. Печать на капсулах из натурального минерального вещества.

Обратите внимание и на другие формы аргинина EXTRIFIT®! ARGININE 1000 MG cps, или аргинин FREE FORM и PEPTIDES ARGININE, наивысшая форма аргинина в пептидной форме, которая обеспечивает максимально возможное всасывание и действие аргинина!

ARGININE AKG 1000 MG CAPS — это продукт, содержащий свободную аминокислоту L-аргинин AKG в капсулах. L-аргинин — это аминокислота, традиционно используемая главным образом в силовых видах спорта. Аргинин является известным прекурсором оксида азота, употребление которого помогает накачивать мышцы во время тренировки.

Смысл накачивания мышц не только в том, что вы чувствуете себя на тренировке отлично! Накачивание мышц означает улучшенное кровообращение в них, что в свою очередь ведет к скорейшей и более интенсивной доставке питательных веществ в мышцы, конечно, при условии употребления вами качественной пищи.

Лучшее снабжение мышц питательными веществами обеспечит вам больше энергии и выносливости на тренировке. А во время отдыха это значительно способствует регенерации мышц после физической отдачи и, следовательно, их росту.

Большим преимуществом продукта ARGININE AKG 1000 MG / CAPS является точное дозирование аргинина AKG, очень легкая усвояемость и всасывание, обеспеченные тем, что в капсулах нет никаких трудно перевариваемых связующих веществ. Для оптимальной усвояемости не забывайте запить большим количеством воды!

КАК УПОТРЕБЛЯТЬ ARGININE 1000 мг CAPS:

Дозировка зависит от массы тела и интенсивности тренировки. Принимайте по 1-й капсуле за 60 минут до тренировки (продвинутые тренирующиеся с более высокой массой тела — по 2 капсулы) и 1 капсулу сразу после тренинга. Максимальная суточная доза — 3 капсулы.

СОСТАВ и СОДЕРЖАНИЕ АКТИВНЫХ ВЕЩЕСТВ в 1 КПС:

L-аргинин-альфа-кетоглутарат 2:1 1000 мг / 1 кпс

ДОБАВКИ: капсула (желатин, оксид железа (минеральный краситель), шеллак (натуральный полирующий агент)), средство против спекания: магниевые соли жирных кислот (стеарат магния)

Содержание 1-й упаковки:  

100 капсул

Количество ежедневных доз в упаковке:

50 при употреблении 2 кпс в день

назад Питательная Ценность

L-arginine AKG.

Foodchem (Китай). (100 гр., или 500 гр.)

Описание L-arginine AKG. Foodchem (Китай). (100 гр., или 500 гр.):

   Аргинин AKG - это один из самых активных стимуляторов гормона роста.

Оказалось, что прием  ААКG   перед тренировкой значительно увеличивает мышечную силу и выносливость,  т.к.  эта хорошо усваиваемая форма L-аргинина, необходимая для производства оксида азота (NO), обладает сосудорасширяющим действием, благодаря чему в мышечные клетки за короткое время поступает большое количество крови. Как результат, явственно ощущается «пампинг эффект» — лучшая доставка строительных и энергетических компонентов. поскольку повышает уровень оксида азота и тем самым улучшает кровоснабжение мышц, доставку в них питательных веществ и кислорода. В итоге мышцы растут удивительно быстро. Кроме того, в мышцах 

уменьшается содержание молочной кислоты и аммиака, вызывающих мышечное утомление. Большую роль в росте мышц играет тот факт, что на фоне физических нагрузок ААКG стимулирует синтез ГРЧ — главного анаболического гормона тела человека. Приём ААКG намного интенсивнее, чем аргинин расслабляет спазмированные сосуды, уменьшает склонность крови к тромбообразованию, оптимизирует работу иммунной системы и уменьшает время восстановления после тренировок.

ААКG и ПОТЕНЦИЯ
Аргинин альфа-кето-глютарат выражено стимулирует потенцию у мужчин и чувство оргазма у представителей обоих полов. Это происходит потому, что оксид азота способствует активации полового центра в гипоталямусе и от него идут более мощные сигналы вниз к половым органам. В результате этих сигналов происходит кровенаполнение половых органов за счёт активации выработки в их артериях оксида азота, синтез которого усиливается ААКG. За счёт более мощной стимуляции выработки оксида азота ААКG более эффективен, чем аргинин в интенсификации сперматогенеза.

 

РЕКОМЕНДУЕМАЯ ДОЗИРОВКА:

L-аргинин альфа-КГ   продается в различных формах: таблетки, капсулы или порошок. Рекомендуемая дозировка в любой форме  составляет 1500 —  3500 мг.  один или два раза в день на пустой желудок, желательно утром и по крайней мере за 30 минут до тренировки. Не рекомендуется использовать AAKG на срок более 60 — 80 дней.

ПРОТИВОПОКАЗАНИЯ:
Не рекомендуется беременным и кормящим женщинам, при шизофрении, при активном проявлении заболевания вирусом герпеса (симплекс, герпес генитальный).

!ПРОКОНСУЛЬТИРУЙТЕСЬ С ВРАЧОМ, прежде чем употреблять какие-либо добавки!

 
 

Аргинин альфа-кетоглутарат WIRUD по низким ценам в Москве

Каждый белок состоит из определенного ряда аминокислот, и каждая играет свою роль в организме. Некоторые аминокислоты могут воспроизводиться здоровым организмом при определенных условиях, но другие – незаменимые − нужно регулярно получать из еды или пищевых добавок.

Аргинин − это незаменимая аминокислота, которая является частью сложного белка, отвечающего за восстановление скелетных мышц.

Свойства Аккг

АККГ− это комплекс, состоящий из двух молекул аргинина в связке с солью алфакетоглютората. Такое стабильное соединение обеспечивает лучшее поглощение и биодоступность аргинина, являющегося проверенным и действенным донатором оксида азота. NO стимулирует приток крови и кислорода, улучшая белковый анаболизм.

Добавка значительно усиливает дампинг (эффект накачки). Аргинин влияет на правильное питание мышечной ткани, что улучшает набор массы. Аккг также улучшает физическую работоспособность и снижает утомляемость.

Аргинин стимулирует выработку гормона роста, дополнительно усиливая, среди прочего рост новых мышечных волокон. Как вещество, участвующее в процессе образования эндогенного креатина, аргинин оказывает положительное влияние на мышечную силу и регенеративную способность.

Кроме того, аргинин регулирует уровень глюкагона и инсулина и обеспечивает детоксикацию организма, так как является чрезвычайно мощным антиоксидантом. Он эффективно снижает чрезмерную активность свободных радикалов, предотвращая повреждения, которые они могут нанести организму.

Аккг (аргинин альфакетоглютарат) − популярная добавка для бодибилдеров, которая помогает набрать действительно впечатляющую мышечную массу. Благодаря комбинации аргинина и альфакетаглутарата, Аккг работает чрезвычайно эффективно, усиливая эффект аргинина почти вдвое.

Как принимать?

Выпускается в различных формах: порошке, желатиновых капсулах, таблетках, ампулах.
Оптимальная доза – до 5 г в сутки. Прием до тренировки улучшает питание мышц и усиливает пампинг, а на ночь - увеличивает секрецию гормона роста.

Производитель: WIRUD GmbH

Страна: Германия

Срок годности: 24 месяца с даты производства

Продукт не является лекарственным средством.
Не рекомендуем использовать продукцию лицам, не достигшим 18 лет.
Перед началом приема любого продукта обязательно проконсультируйтесь у специалиста!

L-аргинин Arginine AKG | Fit&Shape


Способствует росту и сохранению мышечной массы!        

ARGININE AKG - это продукт, содержащий свободную аминокислоту L-аргинин AKG в капсулах. L-аргинин — это аминокислота, традиционно используемая главным образом в силовых видах спорта. Аргинин является известным прекурсором оксида азота, употребление которого помогает накачивать мышцы во время тренировки.

☝️Накачивание мышц означает улучшенное кровообращение, которое обеспечивает быструю и более интенсивную доставку питательных веществ в мышцы.  Эффект достигается при условии употребления  качественной пищи. Более эффективное снабжение мышц питательными веществами обеспечивает выработку большего количества энергии и увеличивает выносливость на тренировке, а во время отдыха способствует регенерации мышц после физической нагрузки.

☝️Большим преимуществом продукта ARGININE AKG является точное дозирование аргинина AKG, очень легкая усваиваемость и всасывание, обусловленные тем, что в капсулах нет никаких плохо перевариваемых связующих веществ.

ARGININE AKG:

☑️улучшает накачку мышц нутриентами;
☑️повышает силовой потенциал организма;
☑️предупреждает уменьшение мышечной массы;
☑️помогает бороться с усталостью.

Способ приема:

Рекомендуется принимать 3 капсулы до и 3 капсулы после тренировки. В дни без тренировки принимайте  3-6 капсул между приемами пищи. Для оптимальной усвояемости не забывайте запить большим количеством воды!

Предостережения и условия хранения:

Этот продукт рекомендуется использовать не в качестве альтернативы разнообразному рациону питания, а как часть сбалансированной диеты для здорового образа жизни. Не превышайте рекомендуемую суточную норму.

Употребление продукта не рекомендуется детям, а также женщинам в период беременности и кормления грудью. 

Хранить в прохладном, сухом месте, недоступном для детей. 

Указанный срок годности действителен только для продукта в неповрежденной упаковке и при соблюдении всех условий хранения. 

Производитель не несет ответственности за любые убытки, причиненные в результате неправильного использования или хранения.

Состав:

ARGININE AKG 3:1
100 г Порция (3 капсулы)
Энергетическая ценность 0 Ккал/0 КДж 0 Ккал/0 КДж
Жиры 0 г 0 г
   в т. ч. насыщенные 0 мг 0 мг
   в т.ч. транс жиры 0 мг 0 мг
Протеин (белок) 0 г 0 г
Углеводы 0 г 0 г
   в т.ч. сахара 0 г 0 г
Соль (NaCl) 0 мг 0 мг
Холестерин 0 мг 0 мг
альфа-кетоглутарат L-аргинина 3:1 ** 1950 мг

Ингредиенты:

альфа-кетоглутарат L-аргинина 3:1, твердая желатиновая капсула.

Упаковка - 120  капсул

Отзывов (0)

Написать отзыв

Нет отзывов об этом товаре.

Аргинин Альфа-кетоглутарат Arginine AKG Swanson, 1000 мг 90 капсул

Описание

Аргинин АКГ (AKG) с окисью азота максимальной силы, Maximum Strength Arginine, 1000 мг 90 капсул, Swanson

Максимальная сила аргинина АКГ (AKG) с окисью азота, 1000 мг 90 капсул L-аргинин-альфа-кетоглютарат для получения наилучшего эффекта. Быстрое восполнение недостатка энергии и восстановление мышц после физических нагрузок. Нормализация здорового кровотока для оптимального обеспечения клеток кислородом и питательными веществами. Альфа-кетоглютарат является соединением аминокислот и применяется для улучшения метаболизма энергии. Ускоряет усваивание организмом L- аргинина.

Производитель Аргинина АКГ (AKG) с окисью азота: Swanson Ultra, США.

Форма выпуска Аргинина АКГ (AKG) с окисью азота: желатиновые капсулы, по 90 шт. в упаковке.

Разовая доза: 1 капсула. Состав 1 дозы:

Количество вещества в 1 дозе L-аргинин AKG (альфа-кетоглютарат в соотношении 2: 1) 1 г

Прочие ингредиенты: желатин, может содержать стеарат магния и диоксид кремния.

Функциональные свойства Аргинина АКГ (AKG) с окисью азота:

-Является необходимым элементом формирования мышечной ткани.

-Улучшает работу иммунной и кровеносной системы

-Нормализует сперматогенез.

-Поддерживает здоровый уровень артериального давления.

-Снижает количество вредного холестерина в организме.

-Способствует восстановлению поврежденных связок и костей, ускоряет заживление ран.

-Борется с ранним старением.

-Помогает мозговой деятельности, улучшает физическую и психическую устойчивость.

Показания к применению Аргинина АКГ (AKG) с окисью азота:

-Заболевания печени.

-Спортсменам для роста мышечной массы и повышения выносливости.

-Нарушения сексуальных функций у мужчин.

-Бесплодие (мужское и женское).

-Диабет.

-Заболевания почек.

-Высокие умственные нагрузки.

Способ применения Аргинина АКГ (AKG) с окисью азота: по 1 капсуле 2–3 раза в день, запивая водой.

Меры предосторожности: не применять при беременности, кормлении грудью. Не давать детям. При наличии заболеваний почек или печени перед началом приема необходима консультация лечащего врача. В случае появления тошноты, спазмов в животе, диареи, рекомендуется снизить дозу препарата.

Противопоказания: повышенная чувствительность к действующему веществу. Признаки недостатка аргинина в организме: высокое давление, ухудшение работы мозга, дисфункция гормонального обмена, низкий уровень либидо, раннее старение, увеличение массы тела.

 

 

L-Аргинин АКГ 200 г Wirud

Аргинин (или L-аргинин) — условно незаменимая алифатическая аминокислота. Основной донатор оксида азота и его переносчик. Аргинин снабжает азотом систему ферментов, называемых NO-синтазами, которые синтезируют NO, — или оксид азота. Оксид азота - это медиатор, регулирующий тонус сосудов артериального русла, от которого зависит артериальное давление. При недостатке аргинина и недостаточной активности NO-синтаз артериальное давление возрастает.

Аргинин альфа-кетоглутарат (ААКГ) - соль аминокислоты аргинина и альфа-кетоглутаровой кислоты. Приобрела популярность как добавка для пампинга в бодибилдинге. Результаты исследований показали, что ААКГ безопасен и помогает увеличивать силовые показатели. Теперь ААКГ - это одна из самых популярных добавок, которая играет важную роль в делении мышечных клеток, восстановлении мышц после тренировок, заживлении травм, удалении шлаков и увеличении продукции соматотропного гормона.

Аргинин служит как носитель и донатор азота, который необходим в синтезе мышечной ткани, именно эта функция явилась главным фактором распространения аргинина в бодибилдинге. Аргинин способствует увеличению мышечной массы и уменьшению жиров при адекватной физической нагрузке. Аргинин является донатором оксида азота, открытие полезных свойств которого было удостоено Нобелевской премии в медицине. Аргинин участвует в цикле переаминирования и выведения из организма конечного азота, то есть продукта распада отработанных белков. От мощности работы цикла (орнитин — цитруллин — аргинин) зависит способность организма создавать мочевину и очищаться от белковых шлаков.

L-аргинин в продуктах питания
Аргинин является условно незаменимой кислотой, потому что он может синтезироваться в организме человека. Однако организм не может произвести достаточное количество аргинина, и некоторое его количество должно поступать с пищей или со спортивным питанием. В бодибилдинге аргинин используются в значительных дозах, так как преследуются несколько другие цели.
Аргинин содержится в продуктах: творог, сыр, и другие молочные продукты, мясо, морепродукты, зерновые культуры, орехи и др.

Эффекты аргинина:

  • Донатор оксида азота
  • Улучшает питание мышц
  • Ускоряет восстановление
  • Ускоряет заживление травм
  • Снижает артериальное давление
  • Улучшает эректильную функцию
  • Улучшает транспорт креатина в мышцы
  • Способствует пампингу
  • Антиоксидантные свойства
  • Усиливает секрецию гормона роста
  • Снижает вредный холестерин
  • Укрепляет иммунитет

L-аргинин в бодибилдинге
Аргинин - это одна из самых популярных добавок, которая доступна в чистом виде, а также входит в состав других продуктов. Аргинин играет важную роль в делении мышечных клеток, восстановлении мышц после тренировок, заживлении травм, удалении шлаков, иммунной системе, а также увеличивает продукцию соматотропного гормона.
Немаловажное свойство аргинина в бодибилдинге - его способность улучшать эректильную функцию, в этом случае может применяться совместно с йохимбином.

Побочные эффекты аргинина
При употреблении аргинина в больших дозах (более 15 г в сутки) может возникнуть диарея, слабость, тошнота, падение артериального давления. При возникновении побочных эффектов снизьте дозировку до уровня, при котором вы не будете испытывать никакого дискомфорта.

Будьте осторожны с добавками, содержащими аргинин, — слишком большое его количество может негативно сказаться на поджелудочной железе. По меньшей мере одно опубликованное научное исследование указывает на то, что прием данной аминокислоты привел к развитию панкреатита, воспалению поджелудочной железы.

Как принимать L-аргинин

Сколько?
Для набора мышечной массы аргинин рекомендуется принимать в дозах от 3 до 9 г в сутки. Чем выше доза, тем ощутимее эффект, однако не рекомендуется превышать дозу более 10 г. Начинайте прием с наименьшей дозы, затем постепенно увеличивайте ее.

Когда?
Лучшее время для приема аргинина: перед тренировкой, после тренировки - для улучшения питания мышц и пампинга. На ночь - для усиления секреции гормона роста.

Как?
Размешать в стакане холодной воды или добавить в протеиновый коктейль (если L-аргинин представлен порошком). В капсулах и таблетках L-аргинин запить водой или любым другим напитком.

Сочетание аргинина со спортивным питанием
​Аргинин используется не только как самостоятельная добавка, но и транспортная система. За счет повышения кровотока в мышцах, аргинин улучшает доставку всех питательных веществ к мышечным клетками. В частности, его используют как транспортную систему для креатина, поэтому их желательно принимать одновременно. Очень часто аргинин входит в состав предтренировочных комплексов. ​​

Аргинин альфа-кетоглутарат (ААКГ) - соль аминокислоты аргинина и альфа-кетоглутаровой кислоты. Приобрела популярность как добавка для пампинга в бодибилдинге. Результаты исследований показали, что ААКГ безопасен и помогает увеличивать силовые показатели. Теперь ААКГ - это одна из самых популярных добавок, которая играет важную роль в делении мышечных клеток, восстановлении мышц после тренировок, заживлении травм, удалении шлаков и увеличении продукции соматотропного гормона.

Кодоны и антикодоны

Кодоны и антикодоны
Увеличить / уменьшить размер на вашем мониторе: Управление типом ПК (Ctrl) + Команда типа MAC (⌘) +

Таблица триплетов оснований ДНК, кодонов РНК и антикодонов в HTML

Уэйн П. Армстронг Обновлено 8 фев.2021 г.

Аминокислота

Кодирующая цепь ДНК
Триплеты оснований
не транскрибируются

Нить матричной ДНК
Триплеты оснований
Транскрибируемые

Кодоны информационной РНК
, комплементарные матричной ДНК
ID кодирующей ДНК (кроме T / U)

Перенос антикодонов РНК
, комплементарных кодонам М-РНК

аланин

GCT, GCC, GCA, GCG

CGA, CGG, CGT, CGC

GCU, GCC, GCA, GCG

CGA, CGG, CGU, CGC

аргинин

CGT, CGC, CGA, CGG
AGA, AGG

GCA, GCG, GCT, GCC
TCT, TCC

CGU, CGC, CGA, CGG
AGA, AGG

GCA, GCG, GCU, GCC
UCU, UCC

аспарагин

AAT, AAC

ТТА, ТТГ

AAU, AAC

UUA, UUG

аспарагиновая кислота

GAT, GAC

CTA, CTG

ГАУ, ГАК

CUA, CUG

цистеин

ТГТ, ТГК

ACA, ACG

УГУ, УГК

ACA, ACG

глютаминовая кислота

ГАА, ГАГ

CTT, CTC

ГАА, ГАГ

CUU, CUC

глутамин

CAA, CAG

GTT, GTC

CAA, CAG

ГУУ, ГУК

глицин

GGT, GGC, GGA, GGG

CCA, CCG, CCT, CCC

GGU, GGC, GGA, GGG

CCA, CCG, CCU, CCC

гистидин

CAT, CAC

ГТА, ГТГ

CAU, CAC

ГУА, ГУГ

изолейцин

ATT, ATC, ATA

TAA, TAG, TAT

AUU, AUC, AUA

UAA, UAG, UAU

лейцин

TTA, TTG, CTT, CTC
CTA, CTG

AAT, AAC, GAA, GAG
GAT, GAC

UUA, UUG, CUU, CUC
CUA, CUG

AAU, AAC, GAA, GAG
GAU, GAC

лизин

AAA, AAG

ТТТ, ТТС

AAA, AAG

UUU, UUC

метионин
(начало)

АТГ

ТАС

АВГ

ОАК

фенилаланин

ТТТ, ТТС

AAA, AAG

UUU, UUC

AAA, AAG

пролин

CCT, CCC, CCA, CCG

GGA, GGG, GGT, GGC

CCU, CCC, CCA, CCG

GGA, GGG, GGU, GGC

серин

TCT, TCC, TCA, TCG
AGT, AGC

AGA, AGG, AGT, AGC
TCA, TCG

UCU, UCC, UCA, UCG
AGU, AGC

AGA, AGG, AGU, AGC
UCA, UCG

останавливаться

TAA, TAG, TGA

ATT, ATC, ACT

UAA, UAG, UGA

AUU, AUC, ACU

треонин

ACT, ACC, ACA, ACG

ТГА, ТГГ, ТГТ, ТГК

ACU, ACC, ACA, ACG

УГА, УГГ, УГУ, УГК

триптофан

ТГГ

ACC

UGG

ACC

тирозин

ТАТ, ТАС

ATA, ATG

UAU, UAC

AUA, AUG

валин

GTT, GTC, GTA, GTG

CAA, CAG, CAT, CAC

ГУУ, ГУК, ГУА, ГУГ

CAA, CAG, CAU, CAC

Над диаграммой кодонов как изображение JPEG:

YNCO0012C | SGD


Систематическое имя
YNCO0012C
SGD ID
SGD: S000006705
Псевдонимы
tR (ACG) O , тРНК-Арг
Тип элемента
ген тРНК
Описание
ТРНК аргинина (тРНК-Arg), предсказанная анализом тРНКскан-SE; один из 6 генов ядерной тРНК, содержащих тДНК-антикодон ACG (преобразованный в ICG в зрелой тРНК), декодирует кодоны CGU, CGC и, вероятно, CGA в аргинин, одну из 19 ядерных тРНК для аргинина 1 2 3
Сравнительная информация
Детали последовательности

Последовательность

Модель S. cerevisiae Контрольная последовательность генома получена из лабораторного штамма S288C. Загрузите последовательность ДНК или белка, просмотрите геномный контекст и координаты. Нажмите «Сведения о последовательности», чтобы просмотреть всю информацию о последовательности для этого локуса, включая для других штаммов.


Подробности генной онтологии

Онтология генов

Аннотации GO состоят из четырех обязательных компонентов: продукт гена, термин из одного из трех Управляемые словари Gene Ontology (GO) (Молекулярная функция, Биологический процесс и Cellular Component), ссылку и код доказательства.SGD вручную настроил аннотации GO с высокой пропускной способностью, оба на основе литература, а также расчетные или прогнозные аннотации. Щелкните «Подробная информация об онтологии гена» для просмотра. вся информация GO и доказательства для этого локуса, а также биологических процессов, которые он разделяет с другими генами.


Детали фенотипа

Фенотип

Аннотации фенотипов для гена - это курируемые единичные мутантные фенотипы, требующие наблюдаемого (е.g., «форма клетки»), квалификатор (например, «аномальный»), тип мутанта (например, нулевой), фон штамма, и ссылка. Кроме того, аннотации классифицируются как классическая генетика или высокопроизводительные. (например, крупномасштабное обследование, систематический набор мутаций). По возможности, информация об аллелях и предоставляются дополнительные сведения. Нажмите «Подробности фенотипа», чтобы просмотреть все аннотации фенотипа и доказательства этого локуса, а также фенотипов, которые он разделяет с другими генами.


Резюме
Несущественный ген; нулевые мутанты медленно растут при воздействии восстановителя 1,4-дитиотреитола
Подробности взаимодействия

Взаимодействие

Аннотации взаимодействия курируются BioGRID и включают физические или наблюдаемые генетические взаимодействия между как минимум двумя генами.Аннотация взаимодействия состоит из типа взаимодействия, имени интерактор, тип анализа (например, двухгибридный), тип аннотации (например, ручной или высокопроизводительный) и ссылка, а также другие экспериментальные детали. Нажмите «Сведения о взаимодействии», чтобы просмотреть все взаимодействия. аннотации и свидетельства для этого локуса, включая визуализацию взаимодействия.


Всего 1 взаимодействий для 1 уникального гена

Подробности регламента Постановление

Количество предполагаемых регуляторов (генов, которые регулируют его) и мишеней (генов, которые он регулирует) для данный локус, основанный на экспериментальных данных. Эти доказательства включают данные, полученные с помощью высокопроизводительные методы. Нажмите «Сведения о нормативных положениях», чтобы просмотреть все аннотации к нормативным положениям, общий доступ обогащение среди целей регулирования и диаграмма регулятор / цель для локуса.


Сведения о литературе

Литература

Вся литература, подобранная вручную по указанному гену, организована по темам в соответствии с их отношение к гену (основная литература, дополнительная литература или обзор).Нажмите "Сведения о литературе". для просмотра всей литературной информации по этому локусу, включая общую литературу по генам.


Первичный
5
Дополнительный
16
Обзоры
5

ресурсов


Memorial Sloan Kettering Cancer Center

Аргинин - это аминокислота, которая синтезируется в организме. Пероральный аргинин применялся при различных состояниях, таких как гипертония, стенокардия, атеросклероз, мигрень и эректильная дисфункция. Считается, что его сосудорасширяющие свойства ответственны за положительный эффект. Аргинин также используется для улучшения заживления ран, улучшения иммунной функции и улучшения спортивных результатов.

Некоторые исследования подтверждают использование аргинина при заболеваниях коронарных и периферических артерий (10) (11) (12) (13) , но длительный прием добавок ухудшил PAD (14) .Кроме того, пероральный прием добавок у пациентов с острым инфарктом миокарда не улучшил фракцию выброса или жесткость сосудов и может быть связан с более высокой смертностью (38) . Мета-анализ добавки аргинина на маркеры сердечно-сосудистых заболеваний, ожирения или диабета также не обнаружил положительных результатов, за исключением, возможно, избранной группы пациентов (39) . Более мелкие исследования показывают, что добавление аргинина, глутамина и HMB может улучшить функцию эндотелия сосудов у пожилых людей (33) , но добавление аргинина само по себе не улучшило кровоток или работоспособность мышц у пожилых женщин (34) .

Наряду с витаминами-антиоксидантами аргинин снижает частоту преэклампсии у женщин с высоким риском (28) , но добавки аргинина не улучшают артериальное давление или функцию почек у женщин с преэклампсией (15) . Предварительные данные предполагают потенциальную пользу приема аргинина при эректильной дисфункции (16) (40) . Аргинин в сочетании с ибупрофеном может усиливать обезболивание у пациентов с мигренью (17) . Энтеральный аргинин снижает шок у пациентов с тяжелыми ожогами (4) и может быть полезен в качестве дополнительной терапии у пациентов с активным туберкулезом (29) .

У онкологических больных предварительные результаты смешаны для периоперационных энтеральных смесей, обогащенных аргинином для улучшения заживления ран (1) (41) и иммунной функции (27) (35) (42) , но другие исследования показывают, что такие формулы могут уменьшить осложнения и продолжительность пребывания в больнице (30) (36) . Некоторые данные предполагают, что профилактическая добавка, содержащая аргинин, может снизить частоту синдрома кистей и стоп у пациентов с гепатоцеллюлярной карциномой, принимающих сорафениб (43) .Интересно, что лечение на основе аргининовой депривации также рассматривается как потенциальное лечение рака. (31) (32) (37) .

Хотя метаанализ не обнаружил значительного влияния добавок аргинина на воспалительные биомаркеры, анализ подгрупп предполагает, что он может увеличивать циркулирующий С-реактивный белок у онкологических больных, у пациентов старше 60 лет или с более высокими исходными уровнями СРБ, или при использовании энтерального введения. формулы (44) .Необходимы дополнительные исследования, чтобы определить обстоятельства, при которых добавление аргинина может быть безопасным и эффективным.

Полимерный наноноситель с пептидом, активирующим кислотность опухоли, обогащенным аргинином (R9), для улучшенной доставки лекарств

* Соответствующие авторы

Первая народная больница Гуанчжоу, медицинский факультет Южно-Китайского технологического университета, Гуанчжоу 510006, P. R. Китай
Эл. Почта: [email protected], [email protected]

б Институты наук о жизни, Школа медицины, Южно-Китайский технологический университет, Гуанчжоу, Гуандун 510006, P.R. Китай

с Школа биомедицинских наук и инженерии, Международный кампус Гуанчжоу, Южно-Китайский технологический университет, Гуанчжоу 510006, П. Р. Китай

д Народная больница провинции Гуандун, Академия медицинских наук Гуандун, Университет китайской медицины Гуанчжоу, Гуанчжоу, Гуандун 510006, P. R. Китай

e Ключевая лаборатория биомедицинских материалов и инженерии Министерства образования, Южно-Китайский технологический университет, Гуанчжоу 510006, П. Р. Китай

f Ключевая лаборатория биомедицинской инженерии провинции Гуандун и Инновационный центр восстановления и реконструкции тканей Южно-Китайского технологического университета, Гуанчжоу 510006, P.R. Китай

г Гуанчжоуская лаборатория регенеративной медицины и здоровья Гуандун, Гуанчжоу 510005, Китайская Республика

Аминокислоты и их символы

д. е.
Аминокислоты Символы Кодоны
Аланин Ала А GCA, GCC, GCG, GCU
Цистеин Cys C УГК, УГУ
Аспарагиновая кислота Жерех D GAC, GAU
Глутаминовая кислота Glu E ГАА, ГАГ
фенилаланин Phe F UUC, UUU
Глицин Gly грамм GGA, GGC, GGG, GGU
Гистидин Его ЧАС CAC, CAU
Изолейцин Иль я AUA, AUC, AUU
Лизин Lys K AAA, AAG
лейцин Лея L UUA, UUG, CUA, CUC, CUG,
метионин Встретились M AUG
аспарагин Asn N AAC, AAU
Пролин Pro п CCA, CCC, CCG, CCU
Глютамин Gln Q CAA, CAG
Аргинин Arg р AGA, AGG, CGA, CGC, CGG, ГЕ
Серин Сер S AGC, AGU, UCA, UCC, UCG, UCU
Треонин Thr Т ACA, ACC, ACG, ACU
Валин Вал V GUA, GUC, GUG, GUU
Триптофан Trp W UGG
Тирозин Тюр Y ОАК UAU

DALRD3 кодирует белок, мутировавший при эпилептической энцефалопатии, который нацелен на тРНК аргинина для модификации 3-метилцитозина

METTL2 взаимодействует с предполагаемым тРНК-связывающим белком DALRD3

Чтобы идентифицировать белки, которые взаимодействуют с METTL2Aonic человека или 2T человека, мы создали линии клеток, стабильно экспрессирующие METTL2A или METTL2B, слитые с меткой очистки Twin-Strep 35 . Для сравнения мы также создали клеточную линию 293T, стабильно экспрессирующую Strep-tagged METTL6, другой гомолог Trm140 человека. Strep-METTL2A, METTL2B и METTL6 подвергали аффинной очистке из экстрактов цельных клеток на стрептактиновой смоле, элюировали биотином и анализировали путем окрашивания серебром для обнаружения взаимодействующих белков. Мы идентифицировали близко мигрирующий дублет полос ~ 50 кДа вместе с полосой ~ 30 кДа, которые были обогащены METTL2A и METTL2B по сравнению с контрольной очисткой (рис. 1a, стрелки).Иммуноблоттинг с использованием антител против метки Strep показал, что одна из полос 50 кДа была очищенной Strep-METTL2A / B (дополнительный рисунок 1). Очистка METTL6 давала полосы ~ 60, 40 и 30 кДа (рис. 1а, стрелки). Полоса 40 кДа соответствует очищенному Strep-METTL6, обнаруженному иммуноблоттингом с антителами против метки Strep (дополнительный рисунок 1).

Фиг. 1: METTL2A / B человека взаимодействует с антикодон-связывающим доменом DALR, содержащим 3 (DALRD3).

a Анализ окрашивания серебром очищенных Strep-METTL2A, 2B и 6 из человеческих клеток 293T.Стрелки обозначают полосы, которые обогащены METTL2A, 2B и 6 очистками по сравнению с контролем. Звездочки обозначают неспецифические загрязнители, обнаруженные во всех трех очистках. b Белковые совпадения, обнаруженные с помощью ЖХ-МС анализа пептидов, присутствующих в указанных очистках белков. c Иммуноблот-анализ контроля, очистки METTL2A, METTL2B и METTL6. Иммуноблоттинг зондировали антителами против TwinStrep и против DALRD3. Вход составляет 1% от общей суммы. Звездочка представляет собой неспецифическую полосу.Процент очищенного DALRD3 представляет собой долю DALRD3, извлеченную из общего количества введенных при каждой очистке. N = 1. d Покрытие обратной очистки DALRD3 в образцах белка, проанализированных с помощью ЖХ-МС. e Схема цитозольной аргинил-тРНК-синтетазы (RARS), митохондриальной аргинил-тРНК-синтетазы (RARS2) и DALRD3. Указаны домены, представляющие митохондриальный нацеливающий сигнал (MTS), каталитическое ядро ​​аминоацилсинтетазы и антикодон-связывающий домен DALR.Исходные данные представлены в виде файла исходных данных.

Для идентификации взаимодействующих с METTL белков все элюаты после каждой очистки обрабатывали для идентификации пептидов с помощью жидкостной хроматографии-тандемной масс-спектрометрии (ЖХ-МС). Как и ожидалось, пептидные последовательности, соответствующие METTL2A, METTL2B и METTL6, были обнаружены в соответствующих очистках Strep-METTL2A, 2B и 6 (фиг. 1b). Кроме того, обе очистки METTL2A и 2B содержали пептиды, соответствующие не охарактеризованному белку, кодируемому геном DALR антикодон-связывающего белка 3 ( DALRD3 ) (рис.1b, дополнительные данные 1). Молекулярные массы двух предсказанных изоформ DALRD3 составляют 55 и 59 кДа, что соответствует по размеру неидентифицированным полосам в дублете, наблюдаемым при окрашивании серебром. Для очистки METTL6 мы обнаружили многочисленные пептиды серил-тРНК синтетазы (SARS) (рис. 1b, дополнительные данные 1). Молекулярная масса SARS (59 кДа) близко по размеру к полосе 60 кДа, обнаруженной окрашиванием серебром при очистке METTL6. Более того, SARS был недавно идентифицирован как взаимодействующий с METTL6 32 .Однако пептиды, соответствующие DARLD3, не были идентифицированы при очистке METTL6. Эти результаты предполагают, что DALRD3 формирует уникальное взаимодействие с METTL2A и 2B.

Чтобы подтвердить взаимодействие DALRD3 и его специфичность, мы временно экспрессировали и очищали METTL2A, METTL2B и METTL6 с последующим зондированием антителами против DALRD3. Иммуноблот-анализ выявил совместную очистку эндогенного DALRD3 со Strep-METTL2A или METTL2B, которая не была очевидна со Strep-METTL6 (рис.1в). В качестве дополнительного доказательства того, что METTL2A и B взаимодействуют с DALRD3, мы также выполнили реципрокную очистку DALRD3 из клеток 293T человека, стабильно экспрессирующих Strep-tagged DALRD3. Используя анализ ЖХ-МС, мы обнаружили несколько уникальных совпадений пептидов с METTL2A и 2B при очистке DALRD3, что указывает на связь между DALRD3 и эндогенным METTL2A / B (рис. 1d, дополнительные данные 2). Эти результаты идентифицируют DALRD3 как взаимодействующего партнера METTL2A и 2B.

DALRD3 представляет собой не охарактеризованный белок, содержащий карбокси-концевую последовательность, гомологичную «DALR» антикодон-связывающему домену, обнаруженному в аргинил-тРНК-синтетазах от архей до эукариот 36 .Домен DALR назван в честь характерных консервативных аминокислот, присутствующих в последовательности первичного белка, и складывается в полностью альфа-спиральную структуру, как это наблюдается в S. cerevisiae аргинил-тРНК-синтетазе 36,37,38 . В отличие от карбоксиконца, аминоконцевая часть DALRD3 не содержит узнаваемых мотивов или доменов и специфична только для гомологов DALRD3. В то время как гомологи DALRD3 еще не идентифицированы у одноклеточных эукариот или беспозвоночных, гомологи DALRD3 могут быть обнаружены у всех секвенированных позвоночных, от примитивных бесчелюстных рыб до млекопитающих 39,40 . У позвоночных канонический домен DALR обнаруживается в цитоплазматической аргинил-тРНК синтетазе 1 (RARS1) и митохондриальной аргинил-тРНК синтетазе 2 (RARS2) в дополнение к DALRD3 (Fig. 1e). В отличие от RARS1 и RARS2, однако, DALRD3 лишен узнаваемого каталитического мотива тРНК синтетазы, тем самым подтверждая особую функцию DALRD3 вне аминоацилирования тРНК.

Комплекс METTL2-DALRD3 связывает различные тРНК аргинина

Основываясь на структуре S. cerevisiae аргинил-тРНК синтетазы, домен DALR образует карман связывания нуклеиновой кислоты, который распознает сторону малой бороздки стеблей антикодона аргининовой тРНК через дер Ваальса, гидрофобные и электростатические взаимодействия 37 .Таким образом, мы исследовали, взаимодействует ли DALRD3 с тРНК, и если да, существует ли конкретная специфичность связывания для DALRD3. Чтобы выяснить взаимодействия РНК, опосредованные DALRD3, мы временно экспрессировали и очищали Strep-DALRD3 из клеток 293T либо отдельно, либо с помощью FLAG-METTL2A / B (рис. 2a). После связывания со стрептактиновой смолой мы подтвердили очистку Strep-DALRD3 вместе с совместной очисткой METTL2A или 2B (рис. 2а). Эти результаты дополнительно подтверждают взаимодействие между DALRD3 и METTL2A / B, как показано выше.

Рис. 2: DALRD3 образует комплекс с METTL2A / B для связывания различных тРНК аргинина.

a Иммуноблотинг Strep-DALRD3, очищенного из клеток 293T, экспрессированных отдельно или в сочетании с FLAG-METTL2A / B. Иммуноблоттинг зондировали антителами против TwinStrep и против FLAG. Нагрузка представляет собой полосу неспецифического белка, обнаруженную антителом против Strep, используемым в качестве контроля нагрузки. b Окрашивание нуклеиновой кислотой РНК, экстрагированных из указанных исходных или очищенных образцов после денатурирующего PAGE.Обозначены паттерны миграции 5.8S рРНК (~ 150 нуклеотидов), 5S рРНК (~ 120 нуклеотидов) и тРНК (~ 70-80 нуклеотидов). c Нозерн-блот анализ геля в b с использованием указанных зондов. Вход составляет 2% от общего количества экстрактов, используемых для очистки. Процентный выход представляет собой количество РНК при очистке Strep, которая была выделена из общего ввода. Эксперимент проводился трижды с сопоставимыми результатами. Количественный анализ был выполнен на показанном блоте. Исходные данные представлены в виде файла исходных данных.

Затем мы исследовали виды РНК, которые очищали совместно с DALRD3, денатурируя PAGE с последующим окрашиванием нуклеиновой кислотой. Хотя при контрольной очистке РНК не было обогащено, очистка Strep-DALRD3 содержала несколько видов совместно очищающих РНК, которые соответствуют по размеру 5S и 5,8S рРНК вместе с тРНК (фиг. 2b, дорожка 10). Следует отметить, что мы наблюдали значительное снижение совместной очистки 5S и 5.8S рРНК с DALRD3 при совместной экспрессии с METTL2A или 2B (фиг. 2b, сравните дорожку 10 с дорожками 11 и 12).Однако совместная очистка тРНК с DALRD3 сохранялась при совместной экспрессии с METTL2A или 2B. Эти результаты показывают, что DALRD3 взаимодействует с рРНК и тРНК, когда сверхэкспрессируется и очищается отдельно, но смещается в сторону преимущественно связывающих тРНК при сборке в комплекс с METTL2A / B.

Чтобы определить специфичность связывания тРНК DALRD3, мы исследовали очистку DALRD3 для различных тРНК с помощью Нозерн-блоттинга. Примечательно, что мы обнаружили, что очистка DALRD3 была значительно обогащена аргининовыми тРНК, которые, как известно, содержат m3C, генерируемый METTL2A / B (рис.2c, дорожки 10–12, тРНК-Arg-CCU и UCU). Напротив, изоакцепторы тРНК аргинина, лишенные m3C, обнаруживают значительно меньшую совместную очистку с DALRD3 (рис. 2c, дорожки 10–12, тРНК-Arg-UCG, CCG и ACG). В соответствии с предсказанной специфичностью домена DALR для аргининовых тРНК, только фоновые уровни тРНК-Thr-AGU или Ser-UGA присутствовали в любой из очисток DALRD3, независимо от того, экспрессируется ли она совместно с METTL2A / B или без него (рис. 2c, Thr -АГУ и Сер-УГА, переулки 10–12). В совокупности эти результаты раскрывают отчетливую специфичность связывания тРНК для DALRD3, которая контрастирует с аргинил-тРНК синтетазами, которые распознают все изоакцепторы тРНК аргинина независимо от антикодона.

DALRD3 способствует связыванию METTL2A / B с тРНК-Arg-CCU и UCU

Совместная очистка DALRD3 с METTL2A и 2B наряду с особой специфичностью связывания тРНК DALRD3 предполагает, что DALRD3 играет роль в нацеливании на METTL2A / B. специфические тРНК аргинина для модификации m3C. Чтобы проверить эту гипотезу, мы временно экспрессировали Strep-METTL2A или 2B с коэкспрессией FLAG-tagged DALRD3 или без нее в клетках 293T. Иммуноблот-анализ исходных экстрактов подтвердил экспрессию Strep-METTL2A / B либо отдельно, либо с FLAG-DALRD3 (рис.3а, дорожки 2, 3, 5 и 6). Благодаря процедуре трансфекции, METTL2A и 2B проявляли пониженные уровни экспрессии при совместной экспрессии с DALRD3 по сравнению с METTL2A или 2B, экспрессируемыми отдельно. Используя этот подход, мы обнаружили совместную очистку FLAG-DALRD3 со Strep-METTL2A или 2B, что еще раз подтвердило наш вывод о том, что METTL2A / B взаимодействует с DALRD3 (рис. 3a, дорожки 11 и 12). Мы также обнаружили, что взаимодействие между DALRD3 и METTL2A / B сохраняется после обработки РНКазой, что позволяет предположить, что взаимодействие METTL2 с DALRD3 не передается через РНК (дополнительный рис.2).

Рис. 3: DALRD3 опосредует связывание METTL2A / B с тРНК-Arg-CCU и UCU.

a Иммуноблот-анализ очистки Strep-METTL2A / B, экспрессированного отдельно или с FLAG-DALRD3, из эмбриональных клеток человека 293T. Иммуноблоттинг зондировали антителами против TwinStrep и против FLAG. Нагрузка представляет собой полосу неспецифического белка, обнаруженную антителом против Strep, используемым в качестве контроля нагрузки. Вход составляет 2% от общей суммы. b Окрашивание нуклеиновой кислотой РНК, экстрагированных из указанных исходных или очищенных образцов после денатурирующего PAGE.Обозначены паттерны миграции тРНК (70–80 н.), 5.8S рРНК (~ 150 н.) И 5 S рРНК (~ 120 н.). c Нозерн-блоттинг METTL2A / B-ассоциированных РНК с указанными зондами. Справа обозначено известное присутствие или отсутствие m3C и фермента METTL, который генерирует m3C в данной тРНК. Очистку повторяли трижды с аналогичными результатами. Исходные данные представлены в виде файла исходных данных.

Анализ соочищающих РНК выявил совместную очистку тРНК как с METTL2A, так и с 2B (рис.3б, дорожки 8–9 и 11–12). Более того, наблюдалось увеличение количества тРНК, совместно очищаемых с METTL2A или 2B, когда каждая из них коэкспрессировалась с DALRD3 (фиг. 3b, сравните дорожки 8 и 9 с 11 и 12). Увеличение количества тРНК, очищаемых совместно с METTL2A / B при совместной экспрессии с DALRD3, не связано с увеличением экспрессии или очистки METTL2A / B, поскольку фактически в присутствии DALRD3 экспрессировалось и очищалось меньше METTL2A / B (рис. 3a). , дорожки 11 и 12).

Используя Нозерн-блот-гибридизацию, мы обнаружили низкие уровни коочистки тРНК-Arg-CCU и UCU только с METTL2A или B, но не с тРНК-Arg-CCG, ACG или UCG (рис.3c, дорожки 8 и 9). Кроме того, мы обнаружили, что тРНК-Thr-AGU также совместно очищается с METTL2A или 2B, когда экспрессируется отдельно (фиг. 3c, дорожки 8 и 9, Thr-AGU). Для сравнения мы обнаружили только фоновые уровни тРНК-Ser-UGA, тРНК-Gln-UUG или U6 мяРНК в любой из очисток (рис. 3c, дорожки 7–12). Взаимодействие METTL2A и 2B с тРНК-Thr-AGU, Arg-CCU и Arg-UCU, но не с другими изоакцепторами тРНК-Arg или тРНК-Ser-UGA, согласуется с субстратной специфичностью METTL2A / B 32 .Примечательно, что количество тРНК-Arg-CCU или UCU значительно увеличивалось при очистке METTL2A или 2B при совместной экспрессии с DALRD3 (рис. 3c, тРНК-Arg-CCU или UCU, сравните дорожки 8 и 9 с дорожками 11 и 12). ). Напротив, взаимодействие между METTL2A или 2B с тРНК-Thr-AGU было нарушено коэкспрессией с DALRD3 (фиг. 3c, сравните дорожки 8 и 9 с дорожками 11 и 12).

Усиление взаимодействия METTL2A / B с аргининовыми тРНК за счет коэкспрессии DALRD3 свидетельствует о том, что сборка комплекса METTL2-DALRD3 облегчает распознавание и нацеливание на специфические субстраты аргининовой тРНК для модификации m3C.Незначительная совместная очистка тРНК-Arg-CCU или UCU с METTL2A / B при экспрессии отдельно может быть связана с небольшой популяцией METTL2A / B, образующей комплекс с эндогенным DALRD3, что согласуется с нашей первоначальной идентификацией DALRD3 с METTL2A / B через масс-спектрометрии. Более того, обогащение тРНК-Arg-CCU и -UCU в сочетании с сопутствующим снижением связывания тРНК-Thr-AGU с помощью METTL2A / B предполагает, что взаимодействие с DALRD3 ограничивает специфичность связывания тРНК METTL2A / B в отношении определенных изоакцепторов тРНК-Arg. .

тРНК, стабильно связанные с METTL2 и / или DALRD3, могут представлять субстраты, которые еще не были модифицированы с помощью m3C и / или были модифицированы, но не диссоциированы. Чтобы установить относительное состояние модификации m3C совместно очищающих тРНК, мы использовали олигонуклеотидный зонд, который отображает дифференциальную гибридизацию на основе статуса модификации m3C (более подробно описано ниже). Используя этот зонд, мы обнаружили, что DALRD3 очищается совместно как с модифицированной, так и с немодифицированной тРНК-Arg-UCU и Arg-CCU (дополнительный рис.3а). Напротив, мы обнаружили, что большинство тРНК-Arg-UCU и Arg-CCU, которые совместно очищались с помощью METTL2, были модифицированы с помощью m3C (дополнительный рис. 3b). Эти результаты согласуются с тем, что белок DALRD3 связывает немодифицированную тРНК-Arg-UCU или CCU для последующего метилирования при взаимодействии с METTL2.

Требования к последовательности тРНК для метилирования с помощью METTL2-DALRD3

Геномы млекопитающих экспрессируют пять различных изоакцепторов тРНК, которые декодируют кодоны аргинина, но только тРНК-Arg-CCU и Arg-UCU модифицированы, чтобы содержать m3C в положении 32 (рис.4а) 17,20,41 . Интересно, что тРНК-Arg-UCG и Arg-ACG также содержат C32, но не модифицируются METTL2A / B ни в человеческих, ни в мышиных клетках. Проверка петель ствола изоакцептора показывает, что тРНК-Arg-CCU и Arg-UCU содержат U-A в положениях 36 и 37, тогда как тРНК-Arg-CCG, UCG и ACG содержат G-G в положениях 36 и 37 (рис. 4a). Мы также отмечаем, что тРНК-Thr-AGU, которая является субстратом для METTL2A / B, также содержит динуклеотид U-A в положениях 36 и 37 (рис. 4a, Thr-AGU). Более того, A37 модифицируется до N6-треонилкарбамоладенозина (t6A) в тРНК-Arg-CCU и Arg-UCU вместе с тРНК-Thr-AGU.Предыдущие исследования S. cerevisiae и S. pombe показали, что идентичность остатков в петле антикодона вместе с модификацией i6A / t6A в положении 37 играет ключевую роль в распознавании и модификации серил- и треонил-тРНК. в образовании m3C дрожжевым ферментом Trm140 17,25 . В сочетании с исследованиями взаимодействия тРНК, описанными выше, эти наблюдения предполагают возможность того, что DALRD3 распознает специфические тРНК аргинина, частично, через элементы последовательности в петле антикодона, которые включают положения 36 и 37 для облегчения METTL2A-зависимого метилирования.

Рис. 4. Идентичность остатков 36 и 37 в тРНК-Arg-CCU играет ключевую роль в образовании m3C с помощью METTL2A / 2B in vitro.

a Петли антикодона изоакцепторов тРНК-аргинина человека и известные модификации. b Антикодоновые петли тРНК-Arg-CCU, транскрибированной in vitro, и варианты, использованные в c , d . c , d Анализ удлинения праймера тРНК-Arg-CCU и вариантов, инкубированных с водой, векторным контрольным элюатом, очищенным METTL2A или METTL2B, коэкспрессируемым с DALRD3.Длина праймера 23 нт. e Количественная оценка образования m3C в d . Анализ удлинения праймера выполняли более трех раз для c и повторяли три раза для d . Столбцы представляют собой стандартное отклонение от среднего. Статистический анализ выполнялся с использованием однофакторного дисперсионного анализа, а значимость рассчитывалась с использованием критерия множественного сравнения Тьюки. ** P <0,01. P = 0,0034 для WT по сравнению с C32A, 0,0039 для WT по сравнению с U36G, 0.0037 для WT по сравнению с A37G. Исходные данные представлены в виде файла исходных данных.

Чтобы проверить эту гипотезу, мы исследовали метилтрансферазную активность комплексов METTL2-DALRD3, очищенных из клеток человека, на транскрибированных субстратах тРНК-Arg-CCU in vitro. Для мониторинга образования m3C мы использовали анализ удлинения праймера, в котором присутствие m3C приводит к блоку обратной транскриптазы (RT) в положении 32, в то время как отсутствие m3C позволяет считывать и генерировать расширенный продукт. В качестве контроля, чтобы гарантировать, что метилирование происходит в правильном положении, мы протестировали субстрат тРНК-Arg-CCU, в котором C32 был мутирован на A (C32A).Чтобы исследовать потребность в положениях 36 и 37 в метилировании METTL2-DARLD3, мы генерировали субстраты тРНК-Arg-CCU U36G и A37G (рис. 4b).

В качестве положительного контроля мы выполнили удлинение праймера на РНК, полученной из клеток 293T человека, что привело к остановке удлинения в положении 32 тРНК-Arg-CCU, что указывает на модификацию m3C, которая отсутствовала, когда не добавляли RT (рис. 4c). , полосы 1 и 2). Блок RT в положении 32 не был обнаружен для транскрибированной тРНК-Arg-CCU in vitro при предварительной инкубации с водой или очисткой отрицательного контроля (рис.4c, дорожки 3 и 4). Напротив, предварительная инкубация тРНК-Arg-CCU с очищенным METTL2A или 2B с DALRD3 или без него, с последующим удлинением праймера, выявила появление блока RT в положении 32, указывающего на образование m3C (рис. 4c, дорожки 5– 8). Мы отмечаем, что METTL2A / B, очищенный из клеток человека без сверхэкспрессии DALRD3, проявлял активность модификации m3C, что согласуется с совместной очисткой эндогенного DALRD3 с избыточно экспрессируемым METTL2A или 2B с образованием активного комплекса метилтрансферазы.Таким образом, очищенный комплекс METTL2-DALRD3 активен для образования m3C на транскрибируемом in vitro субстрате тРНК без каких-либо других модификаций.

Используя варианты tRNA-Arg-CCU, мы не обнаружили блока RT, когда C32 был мутирован в A, что свидетельствует о том, что положение 32 было сайтом метилирования (Fig. 4d, полосы 1–4). Примечательно, что мутации либо U36, либо A37 в остаток G в tRNA-Arg-CCU приводили к значительному снижению образования m3C (Fig. 4d, полосы 5-10, количественно в 4e). Эти исследования предоставляют доказательства того, что DALRD3 служит фактором различения для распознавания различных тРНК аргинина на основе элементов последовательности, общих для тРНК-Arg-CCU и тРНК-Arg-UCU.

m3C для образования клеточных тРНК аргинина требует DALRD3

Вышеприведенные результаты предполагают, что DALRD3 участвует в распознавании и взаимодействии специфических аргининовых тРНК с METTL2A / B. Чтобы исследовать потребность в DALRD3 в образовании m3C in vivo, мы сконструировали линии клеток человека, лишенные DALRD3, с использованием редактирования гена CRISPR / Cas9. Используя линию гаплоидных клеток человека HAP1 42 , мы создали клон клетки, содержащий делецию 14 пар оснований в экзоне 1 гена DALRD3 (дополнительный рис.4а). Предполагается, что при делеции образуется усеченный DALRD3, в котором отсутствует большая часть полипептида, или сдвиг рамки считывания, который приводит к бессмысленному распаду (NMD). Действительно, иммуноблоттинг выявил отсутствие полноразмерного белка DALRD3 в линии клеток с нокаутом DALRD3 (D3-KO) по сравнению с изогенной контрольной линией клеток дикого типа (WT) (фиг. 5a). Хотя экспрессия DALRD3 была отменена в клеточной линии D3-KO, никаких изменений в уровнях METTL2A не было обнаружено между клеточными линиями WT или D3-KO (дополнительный рис.4б).

Рис. 5: DALRD3 необходим для эффективного образования m3C в тРНК аргинина in vivo.

a Проверка иммуноблотом потери экспрессии DALRD3 в линиях клеток с нокаутом DALRD3 (KO) человека по сравнению с клетками HAP1 человека дикого типа. Актин использовался в качестве контроля нагрузки. Звездочкой обозначена неспецифическая полоса, обнаруженная как в лизатах клеток дикого типа, так и в клеточных лизатах D3-KO. b Схема анализа положительной гибридизации в отсутствие модификации (PHA). c Нозерн-блоттинг зондов PHA, предназначенных для обнаружения m3C в позиции 32, и контрольного зонда, который гибридизуется с другой областью той же тРНК. d Анализ удлинения праймера тРНК-Arg-UCU и Arg-CCU, собранных из обозначенных линий клеток HAP1 человека. Длина грунтовок; тРНК-Arg-UCU, 24 нуклеотида; тРНК-Arg-CCU, 23 н. и Анализ удлинения праймера тРНК-Ser-UGA и Thr-AGU, собранных из обозначенных линий клеток HAP1 человека. Длина грунтовок; тРНК-Сер-УГА, 23 нуклеотида; тРНК-Thr-AGU, 20 н. f Схема вариантов DALRD3, используемых в экспериментах по спасению DALRD3. г Иммуноблот-анализ, подтверждающий экспрессию вариантов DALRD3 в указанных клеточных линиях HAP1. ч. Анализ удлинения праймера тРНК-Arg-CCU из клеточных линий WT или D3KO HAP1, стабильно интегрированных с указанными экспрессирующими конструкциями DALRD3. (-RT) означает, что обратная транскриптаза не добавлялась; м3С-3-метилцитидин; D-дигидроуридин; t6A-треонилкарбамоладенозин; > маркированный зонд. i Количественная оценка образования m3C в тРНК-Arg-CCU путем удлинения праймера. n = 3. Планки погрешностей представляют собой стандартное отклонение от среднего. Статистический анализ выполнялся с использованием однофакторного дисперсионного анализа, а значимость рассчитывалась с использованием критерия множественного сравнения Тьюки.**** P <0,0001; нс, не имеет значения. P = 0,7430 для штамма WT + вектор по сравнению со штаммом D3-KO + WT-DALRD3. a , ( c по e ), g , h были повторены по три раза каждый с аналогичными результатами. Исходные данные представлены в виде файла исходных данных.

Чтобы контролировать образование m3C в тРНК, мы использовали положительную гибридизацию в отсутствие модификации (PHA) анализ (рис. 5b) 43,44,45,46 . Этот анализ на основе Нозерн-блоттинга основан на дифференциальной гибридизации зонда с тРНК, вызванной присутствием или отсутствием m3C, что нарушает спаривание оснований 47,48,49 .Таким образом, уменьшение модификации m3C приводит к увеличению сигнала зонда PHA, который может быть нормализован относительно сигнала зонда из другой области той же тРНК, что и внутренний контроль. Для тРНК-Arg-CCU и UCU мы наблюдали значительное увеличение сигнала зонда PHA в линии клеток D3-KO человека по сравнению с WT, что указывает на потерю модификации m3C в этих конкретных тРНК (рис. 5c). Напротив, не было обнаружено увеличения сигнала PHA ни для тРНК-Ser-UGA, ни для тРНК-Thr-AGU в клеточной линии D3-KO, что согласуется с субстратной специфичностью DALRD3, показанной выше.Мы также отмечаем, что стационарные уровни всех протестированных тРНК оставались сходными между клеточными линиями WT и D3-KO, включая тРНК-Arg-CCU и UCU.

В качестве дополнительной проверки мы отслеживали образование m3C в конкретных клеточных тРНК с помощью анализа удлинения праймера. Как и ожидалось, остановка RT, указывающая на m3C в положении 32 тРНК-Arg-CCU и Arg-UCU, была обнаружена в клетках 293T и HAP1 человека дикого типа (фиг. 5d). Напротив, блок m3C как в тРНК-Arg-CCU, так и в Arg-UCU был значительно снижен в клеточной линии D3-KO с последующим считыванием на следующую модификацию, блокирующую RT (рис.5г, полосы HAP1-D3KO). В соответствии с ролью DALRD3 только в модификации аргинина тРНК, модификация m3C в тРНК-Ser-UGA и Thr-AGU не затрагивается в клеточной линии D3-KO (Fig. 5e). Эти результаты демонстрируют, что DALRD3 необходим для эффективного образования m3C в определенных тРНК аргинина.

Чтобы вскрыть области DALRD3, которые играют роль в образовании m3C, мы проверили способность вариантов DALRD3 восстанавливать образование m3C в линии клеток HAP1-D3KO. Мы создали стабильные клеточные линии, экспрессирующие варианты DALRD3 или DALRD3 дикого типа, лишенные домена DALR или N-концевого удлинения (рис.5f, WT, ΔDALR и ΔNterm). Экспрессию каждого варианта DALRD3 в стабильных клеточных линиях подтверждали иммуноблоттингом (фиг. 5g). Как и ожидалось, клетки HAP1-D3KO с одним вектором не демонстрировали остановки m3C в положении 32 в тРНК-Arg-CCU по сравнению с клетками HAP1-WT (фиг. 5h, сравните дорожки 1 и 2). Повторная экспрессия DALRD3 дикого типа в клетках HAP1-D3KO способна спасти образование m3C в тРНК-Arg-CCU, о чем свидетельствует повторное введение блока m3C RT и отсутствие продуктов считывания (рис.5h, дорожка 3). Напротив, экспрессия мутанта DALRD3, лишенного домена DALR или N-концевого удлинения, была неспособна восстановить образование m3C в тРНК-Arg-CCU (фиг. 5h, дорожки 4 и 5; количественно в 5i). В целом, эти результаты демонстрируют, что образование m3C в положении 32 в специфических аргининовых тРНК требует белка DALRD3, в котором как домен DALR, так и N-концевой участок вносят вклад в ключевые роли в активности метилтрансферазы.

Влияние модификации m3C на экспрессию репортера кодона

Известно, что взаимодействие между нуклеотидами 32 и 38 антикодоновой петли тРНК влияет на распознавание кодонов и связывание тРНК с рибосомой в Escherichia coli 15 .Таким образом, мы исследовали возможные эффекты модификации m3C 32 на функцию тРНК-Arg в синтезе белка с использованием кодон-зависимых репортерных конструкций. Мы создали лентивирусные репортеры, экспрессирующие белок нанолюциферазы, слитый ниже десяти последовательных кодонов AGA или AGG, которые декодируются m3C-содержащей тРНК-Arg-UCU или CCU (дополнительный рис. 5а). Мы также создали репортерные плазмиды, содержащие ряды кодонов CGA или CGC, которые декодируются с помощью тРНК-Arg-UCG или ACG, лишенных m3C. Основываясь на этой системе, мы не обнаружили значительных различий в экспрессии белка между клеточными линиями WT или D3-KO для любого из репортеров кодонов аргинина (дополнительный рис.5б и в). Мы также не обнаружили серьезных изменений в экспрессии контрольной конструкции GFP между клеточными линиями WT и D3-KO (дополнительные рис. 5b и c). Эти результаты предполагают, что модификация m3C оказывает минимальное влияние на эффективность трансляции в этих кодонах-репортерах и / или играет роль в тРНК аргинина, которую невозможно обнаружить с помощью этой экспериментальной системы.

Вариант

DALRD3 , связанный с нарушением развития головного мозга

Из-за возникающих связей между модификацией тРНК и процессами развития нервной системы мы затем исследовали, связан ли DALRD3 с какими-либо неврологическими расстройствами неизвестной генетической этиологии.Мы определили кровнородственную семью с двумя пациентами-братьями и сестрами, демонстрирующими глубокую глобальную задержку развития и стойкую раннюю инфантильную эпилепсию, которые дали отрицательный результат на известные мутации болезни по стандартному кариотипу, хромосомному микрочипу и панели генов эпилепсии (рис. 6а). Семья была идентифицирована путем применения подхода «сначала геномика» к не охарактеризованным пациентам с нарушениями развития нервной системы 50 . Родители - здоровые двоюродные братья и сестры, у них есть еще один здоровый ребенок в дополнение к двум больным детям и одному самопроизвольному выкидышу (рис.6б). Последующее секвенирование экзома под контролем аутозигомного анализа 51 выявило единственную гомозиготную нуклеотидную замену, приводящую к трансверсии С на А в экзоне 9 гена DALRD3 в общей области аутозиготности между двумя затронутыми братьями и сестрами на хромосоме 3 (рис. 6c). ). Подтверждающее секвенирование по Сэнгеру подтвердило полную сегрегацию этого варианта с заболеванием в семье на полностью пенетрантной аутосомно-рецессивной модели, гомозиготной у обоих пациентов и гетерозиготной у родителей и здорового брата или сестры (рис.6г). Ожидается, что генетическое изменение вызовет бессмысленную мутацию из-за введения стоп-кодона UAA в транскрипт мРНК, кодирующий преобладающую изоформу DALRD3 (pTyr417 *). Трансляция этого транскрипта приведет к усеченному белку, лишенному антикодон-связывающего домена тРНК DALR. Кроме того, мРНК варианта DALRD3 может быть подвержена NMD из-за присутствия преждевременного стоп-кодона.

Рис. 6. Идентификация варианта DALRD3 , связанного с задержкой развития и эпилептической энцефалопатией.

a Родословная семьи, несущей бессмысленную мутацию в гене DALRD3 . b Пациенты 1 и 2 (P1 и P2), содержащие гомозиготную мутацию DALRD3 . c Гибкая мультиидеограмма анализа автозиготности исследуемой семьи в виде серии блочных дуг с двумя затронутыми людьми, представленными двумя внешними дугами. Аутозиготные области пораженных индивидуумов отмечены бледно-голубым цветом, участки здоровых индивидуумов - розовым, а гомозиготные участки всех пораженных особей - темно-синим. d Секвенирование по Сэнгеру хроматограмм указанных индивидуумов из семьи в этом исследовании наряду с контрольным индивидуумом дикого типа.

Чтобы определить молекулярное влияние мутации DALRD3 на образование m3C, мы генерировали линии лимфобластоидных клеток (LCL) от двух братьев и сестер (называемых D3-LCL, полученные от пациентов 1 и 2; P1 и P2). LCL, полученные от пораженных пациентов, сравнивали с контрольными лимфобластами от двух этнически сопоставимых, здоровых, неродственных лиц (LCL-WT1 и WT2).В соответствии с нонсенс-мутацией, приводящей к усечению белка DALRD3 и / или NMD, уровни полноразмерного белка DALRD3 были снижены в клеточных лизатах, приготовленных из LCL любого пациента, по сравнению с WT-LCL (фиг. 7a). Используя вышеупомянутый анализ PHA, мы обнаружили существенное увеличение сигнала PHA для тРНК-Arg-CCU и UCU в D3-LCL по сравнению с контрольными клетками дикого типа, что указывает на потерю модификации m3C в этих конкретных тРНК (рис. 7b). Последующее исследование с использованием анализа удлинения праймеров подтвердило серьезное снижение модификации m3C в тРНК-Arg-CCU и UCU обоих D3-LCL от пораженных пациентов (рис.7в, г). Напротив, уровни модификации m3C, обнаруживаемые с помощью гибридизации зонда PHA или удлинения праймера для tRNA-Ser-UGA и tRNA-Thr-AGU, были сходными между D3- и WT control-LCLs (Fig. 7b-d). Дефицит модификации m3C в тРНК аргинина обоих LCL пациентов демонстрирует, что мутация DALRD3 представляет собой аллель частичной потери функции.

Рис. 7. Линии лимфобластоидных клеток, полученные от пациентов с гомозиготным вариантом DALRD3, обнаруживают дефицит в модификации m3C в тРНК аргинина.

a Иммуноблоттинг указанных белков из лизатов, полученных из LCL, полученных от индивидуумов дикого типа (WT) и пациентов P1 и P2, несущих гомозиготную мутацию DALRD3. Звездочки (*) представляют собой неспецифические полосы по обе стороны от белка DARLD3. Блоттинг был повторен дважды с аналогичными результатами. b Нозерн-блот-анализ с использованием зондов PHA, предназначенных для обнаружения m3C в позиции 32, и контрольного зонда, который гибридизуется с другой областью той же тРНК. Блоттинг был повторен трижды с сопоставимыми результатами. c Анализ удлинения праймера указанных тРНК из обозначенных человеческих LCL. (-RT) не представляет собой обратную транскриптазу; m3C 3-метилцитидин; D дигидроуридин; t6A треонилкарбамоладенозин. > маркированный зонд. Анализ удлинения праймера линий лимфобластоидных клеток повторяли трижды. d Количественная оценка образования m3C удлинением праймера для указанных тРНК. n = 2. Исходные данные представлены в виде файла исходных данных.

Эпилептические энцефалопатии (ЭЭ) охватывают большую, разнородную группу расстройств нервного развития с ранним началом, характеризующихся трудноизлечимыми припадками и аномалиями электроэнцефалограммы (см. 52,53 ). У обоих пациентов с мутацией DALRD3 начало приступов произошло в раннем младенчестве в возрасте от 6 до 7 месяцев, что свидетельствует о раннем начале эпилептической энцефалопатии (таблица 1). В то время как эпилепсия пациента 2 могла контролироваться противоэпилептическими препаратами, приступы у пациента 1 плохо контролировались лекарствами. В дополнение к задержке развития и эпилепсии у обоих пациентов наблюдался ряд неврологических и физиологических симптомов, включая тяжелые двигательные и речевые фенотипы, гипотонию и лицевую дисморфию (Таблица 1).Основываясь на совокупности симптомов, характеризующихся одновременным возникновением задержки развития и частой эпилептической активности, оба пациента соответствуют клиническим состояниям, которые теперь классифицируются как энцефалопатия развития и эпилептическая энцефалопатия 54 . В целом, эти данные позволяют идентифицировать людей, у которых отсутствует модификация m3C тРНК аргинина, и выявляют биологическую связь между модификацией m3C тРНК и правильной неврологической функцией.

Таблица 1 Клинический фенотип и молекулярные данные для пациентов с гомозиготными вариантами DALRD3.

Катионные переносчики аминокислот и Salmonella Typhimurium ArgT совместно регулируют доступность аргинина для внутриклеточного роста сальмонелл

Abstract

Катионные переносчики аминокислот (mCAT1 и mCAT2B) регулируют доступность аргинина в макрофагах. Остается понять, как в инфицированной клетке патоген может изменить метаболизм аргинина в организме хозяина. Мы раскрываем здесь новый механизм, с помощью которого Salmonella используют mCAT1 и mCAT2B для приобретения аргинина хозяина для собственного внутриклеточного роста в антигенпрезентирующих клетках.Мы демонстрируем, что Salmonella , инфицированные макрофагами и дендритными клетками костного мозга, демонстрируют повышенное поглощение аргинина и повышенную экспрессию mCAT1 и mCAT2B. Мы показываем, что транспортер mCAT1 находится в непосредственной близости от Salmonella , содержащей вакуоль (SCV), специфически живой внутриклеточной Salmonella для доступа к цитозольному пулу аргинина макрофагов. Кроме того, было обнаружено, что ассоциированный с лизосомами мембранный белок 1, маркер SCV, колокализуется с mCAT1 в инфицированной клетке Salmonella .Затем внутривакуолярная Salmonella приобретает аргинин хозяина через свой собственный транспортер аргинина, ArgT, для роста. Нокаутный штамм argT был неспособен к приобретению аргинина хозяина, и его рост был ослаблен как в макрофагах, так и в модели инфекции на мышах. Вместе эти данные раскрывают стратегии выживания, с помощью которых вирулентные сальмонеллы адаптируются к суровым условиям, преобладающим в инфицированных клетках-хозяевах.

Образец цитирования: Дас П., Лахири А., Лахири А., Сен М., Айер Н., Капур Н. и др.(2010) Катионные переносчики аминокислот и Salmonella Typhimurium ArgT коллективно регулируют доступность аргинина для внутриклеточного роста Salmonella . PLoS ONE 5 (12): e15466. https://doi.org/10.1371/journal.pone.0015466

Редактор: Нияз Ахмед, Хайдарабадский университет, Индия

Поступила: 6 августа 2010 г .; Одобрена: 24 сентября 2010 г .; Опубликовано: 3 декабря 2010 г.

Авторские права: © 2010 Das et al.Это статья в открытом доступе, распространяемая в соответствии с условиями лицензии Creative Commons Attribution License, которая разрешает неограниченное использование, распространение и воспроизведение на любом носителе при условии указания автора и источника.

Финансирование: Эта работа была поддержана грантом Положение (2A) Десятый план (191 / MCB) от директора Индийского института науки, Бангалор, Индия, и Департамента биотехнологии (DBT 197 и DBT 172), Индия. Финансирующие организации не играли никакой роли в дизайне исследования, сборе и анализе данных, принятии решения о публикации или подготовке рукописи.

Конкурирующие интересы: Авторы заявили об отсутствии конкурирующих интересов.

Введение

Salmonella - это грамотрицательные факультативные внутриклеточные бактерии, которые могут инфицировать широкий спектр животных-хозяев через зараженную пищу или воду. Штаммы брюшного тифа, такие как Salmonella enterica, сероваров Typhi и Paratyphi, инфицируют людей, вызывая опасное для жизни системное заболевание, называемое брюшным тифом. С другой стороны, нетифоидные штаммы, такие как Salmonella, Typhimurium и Enteritidis, имеют более широкий круг хозяев и у людей могут вызывать острый гастроэнтерит [1]. Salmonella обладает уникальной способностью выживать и размножаться в макрофагах, и это свойство важно для ее способности вызывать системную инфекцию [2]. Чтобы преодолеть и выжить во враждебной среде, преобладающей внутри макрофагов, Salmonella разработала стратегии, позволяющие избежать врожденных и адаптивных иммунных механизмов хозяина. Оксид азота (NO) и активные формы кислорода являются центральным компонентом врожденного иммунитета хозяина и эффективным противомикробным средством против внутриклеточных патогенов.Однако выживаемость Salmonella в макрофагах свидетельствует о том, что патоген развил механизмы, позволяющие избежать этих иммунных ответов хозяина [3].

Активность iNOS зависит от наличия аргинина. Следовательно, количество аргинина, присутствующего в клетке-хозяине, и способность хозяина и патогена приобретать аргинин могут играть важную роль в формировании судьбы любой инфекции [4]. Аргинин является важным модулятором иммунного ответа хозяина [5], [6].Было показано, что захват аргинина из внеклеточной среды необходим для iNOS-зависимой продукции NO [7]. Давно известно, что классическая активация макрофагов мыши приводит к усилению транспорта аргинина [8]. Было задокументировано несколько систем транспорта аргинина млекопитающих, включая системы y + , B 0+ , b 0+ и y + L [9]. Транспорт на базальном уровне в неактивированных макрофагах происходит через систему y + L, а в активированных макрофагах - через систему y + .Семейство переносчиков катионных аминокислот (CAT) принадлежит к системе y + и включает четыре члена с CAT1 по 4, кодируемых Slc7A1 с по - 4 генами. Аргинин переносится первыми тремя членами семейства переносчиков катионных аминокислот [10]. CAT1 экспрессируется повсеместно, за исключением печени, тогда как CAT3 экспрессируется только в головном мозге. CAT2 имеет два варианта сплайсинга, из которых CAT2A экспрессируется в клетках печени и гладких мышц, а CAT2B - в макрофагах [8].

Интересно, что захват аргинина необходим не только для макрофагов хозяина, но и для возбудителя инфекции.Известно, что несколько патогенов изменяют метаболизм аргинина внутри клеток-хозяев как с патогенной, так и с клеточной точки зрения [11], [12]. Например, внутриклеточная Listeria активирует экспрессию гена arpJ , который является пермеазой аргинина, однажды в организме хозяина [13]. Mycobacterium marinum индуцирует ген argS , который кодирует аргинил-тРНК-синтетазу [14]. Giardia lamblia подавляет продукцию NO внутри макрофагов хозяина, потребляя весь аргинин высокоэффективной транспортной системой аргинина [15].В случае Salmonella наличие системы транспорта аргинина хорошо задокументировано. Таким образом, можно ожидать, что для выживания в жестких условиях питания, преобладающих в клетках-хозяевах, Salmonella может также транспортировать и использовать аргинин-хозяин для лучшего роста и выживания.

Следовательно, наш интерес состоял в том, чтобы определить, может ли внутриклеточная Salmonella приобретать аргинин макрофагов для роста и тем самым снижать доступность цитозольного аргинина для продукции NO.Целью настоящей работы было изучение влияния инфекции Salmonella на пул аргинина хозяина. Мы наблюдали, что Salmonella действительно может получать доступ к цитозольному аргининовому пулу макрофагов и использовать его для синтеза белка, используя как хозяин, так и его эндогенные переносчики аргинина.

Результаты

Инфекция Salmonella увеличивает захват аргинина инфицированными клетками-хозяевами

Известно, что после активации различными стимулами макрофаги увеличивают захват аргинина [11].Аргинин - это важная аминокислота, которая определяет судьбу многих инфекций, регулируя продукцию NO, опосредованную iNOS. Поэтому мы решили определить влияние инфекции Salmonella на способность АРС к транспорту аргинина. Мы измерили транспортную активность BMDM у мышей BALB / c через 12 часов заражения Salmonella . На рис. 1А показано, что инфекция Salmonella привела к заметному увеличению способности BMDM к поглощению аргинина. Чтобы еще больше подтвердить наш результат, мы исследовали общую популяцию клеток печени и селезенки контрольных и инфицированных мышей BALB / c.Как и ожидалось, клетки печени и селезенки инфицированных мышей показали в 3 раза большее поглощение аргинина по сравнению с клетками неинфицированных контрольных мышей (фиг. 1B). Затем мы проверили способность DC к поглощению аргинина, выделенных из мышей BALB / c.

Рисунок 1. Salmonella активирует транспорт аргинина в макрофагах, полученных из костного мозга (BMDM), в печени, селезенке и дендритных клетках мышей.

( A ) BMDM были инфицированы WT Salmonella при MOI 10, а анализ поглощения аргинина проводили через 12 часов после заражения ( B ). 10 6 КОЕ штамма WT и вскрытие через 5 дней после заражения.Неинфицированных (UI) мышей лечили PBS. Клетки печени и селезенки инфицированных мышей или мышей UI подвергали анализу поглощения аргинина. Представленные данные являются одним из трех подобных экспериментов. Статистическая значимость была определена следующим образом: **, P <0,01 (критерий Стьюдента t ).

https://doi.org/10.1371/journal.pone.0015466.g001

Инфекция Salmonella увеличивает уровень переносчиков катионных аминокислот mCAT1 и mCAT2B в BMDM

Чтобы определить механизм, с помощью которого инфекция Salmonella привела к увеличению поглощения аргинина BMDM, общая РНК была выделена из Salmonella инфицированных и неинфицированных BMDM, полученных от мышей BALB / c, для количественного определения мРНК mCAT1 и mCAT2B.Базовая экспрессия мРНК mCAT1 и mCAT2B наблюдалась в неинфицированных BMDM. Однако инфицирование Salmonella в течение 12 часов привело к значительному увеличению мРНК mCAT1 (в 5 раз) и mCAT2B (в 3 раза) по сравнению с неинфицированными макрофагами (рис. 2A – B). Наши результаты согласуются с гипотезой о том, что инфекция сальмонеллы увеличивает поглощение аргинина за счет увеличения экспрессии этих двух переносчиков.

Рисунок 2. Инфекция Salmonella в макрофагах, полученных из костного мозга (BMDM), увеличивает экспрессию мышиного переносчика катионных аминокислот 1 (mCAT1) и мышиного переносчика катионных аминокислот 2 (mCAT2B).

( A ) BMDM инфицировали WT Salmonella при MOI 10, а уровни мРНК mCAT1, mCAT2B и β-actin исследовали с помощью полуколичественной RT-PCR через 12 часов после заражения. ( B ) На графике нанесено среднее кратное увеличение транскрипции mCAT1 и mCAT2B после заражения из трех независимых экспериментов после денситометрического анализа и нормализации с β-актином . Уровни сравниваются между инфицированными и неинфицированными макрофагами из этих экспериментов.Статистическая значимость была определена следующим образом: * P <0,05 (критерий Стьюдента t ).

https://doi.org/10.1371/journal.pone.0015466.g002

Salmonella аргининпермеаза argT необходим для получения аргинина хозяина

Мы предположили, что Salmonella использует аргинин хозяина для роста. Затем мы пошли дальше, чтобы проверить, как патоген усваивает аргинин хозяина. Мы предположили, что специфический переносчик аргинина в бактериальной мембране может транспортировать аргинин хозяина к бактериям.Чтобы доказать это, мы исследовали роль связывающего лизин-аргинин-орнитин периплазматического белка ArgT, кодируемого геном argT (STM 2355). Другими генами, присутствующими в том же опероне, являются hisP и hisMQ , которые кодируют АТФ-связывающий компонент и два интегральных мембранных компонента, соответственно, транспортера лизин / аргинин / орнитин ABC и транспортера гистидина ABC E. coli [16] - [18]. Биоинформатический анализ баз данных неизбыточных белков показал, что несколько пермеаз аргинина как непатогенных, так и патогенных бактерий имеют значительную гомологию с Salmonella ArgT (данные не показаны).

Чтобы проверить, экспрессируется ли белок ArgT внутриклеточной Salmonella , мы сделали удар в штамме, в котором 6 гистидин были помечены на С-конце хромосомного белка ArgT. Мы наблюдали только одну единственную полосу 27 кДа, принадлежащую меченному гистидином белку ArgT. Как было проверено с помощью вестерн-блоттинга, контрольный лизат Salmonella не приводит к образованию какого-либо другого меченного гистидином белка любого размера. Тот же штамм использовали для заражения BMDM, и через 12 часов заражения бактерии очищали и лизировали.Этот белок использовали для измерения количества белка ArgT, экспрессируемого внутриклеточной сальмонеллой . Те же бактерии, выращенные в LB в течение 12 ч, использовали в качестве контроля. Сравнивая количество белка RRF, экспрессируемого во внутриклеточном штамме Salmonella и LB, выращенном Salmonella из нокаутного штамма, мы наблюдали, что белок ArgT активируется примерно в 2–3 раза после инфицирования (рис. 3A – B). Штамм WT был использован в качестве отрицательного контроля, чтобы показать, что Salmonella не содержит в себе белка, меченного гистидином.

Фигура 3. ArgT экспрессируется внутриклеточной Salmonella .

( A ) Показана экспрессия His-меченного белка ArgT в LB, выращенном и из изолированного ArgT :: His, нокаут в бактериях из инфицированного BMDM после выполнения SDS PAGE. У контрольных бактерий WT нет ни одного белка, меченного His такого же размера. Зондирование фактора рециркуляции рибосом (RRF) было выполнено для выравнивания количества бактериального белка, загруженного для SDS PAGE ( B ). Среднее кратное увеличение уровня белка ArgT после инфицирования в течение 12 часов по сравнению с бактериями, выращенными LB из трех независимых были нанесены на график эксперименты после денситометрического анализа и нормализации с использованием фактора рециклинга рибосом (RRF).Статистическая значимость была определена следующим образом: * P <0,05 (критерий Стьюдента t ).

https://doi.org/10.1371/journal.pone.0015466.g003

Чтобы выяснить функцию argT , мы сделали нокаут одного гена в WT Salmonella и подтвердили мутацию штамма различными наборами праймеров. . Штамм не имел дефектов роста ни в минимальных средах LB, ни в M9 (данные не показаны). Емкость поглощения аргинина штамма WT и Δ argT Salmonella затем проверяли in vitro с использованием радиоактивного аргинина.Данные, представленные на фиг. 4A, ясно демонстрируют, что бактерии Δ argT не способны поглощать экзогенный аргинин, как штамм WT. Штамм комплемента (c- argT) ведет себя аналогично штамму WT. Для дальнейшего понимания судьбы производного от хозяина аргинина в Salmonella in vivo мы инфицировали BMDM от мышей BALB / c штаммами WT, Δ argT или c- argT в среде DMEM, не содержащей аргинина. После инфицирования в течение 25 минут добавляли 14 C-аргинин.Через 12 часов инфицирования мы изолировали внутриклеточные бактерии из инфицированных клеток, и бактерии помещали в чашку с антибиотиками для подсчета количества бактерий, присутствующих в различных штаммах. После получения данных КОЕ количество бактерий было нормализовано для различных образцов, и дублированные лунки были использованы для дальнейших экспериментов. Целый бактериальный белок после нормализации был загружен в SDS-страницу, и сканирование с помощью фосфорного сканера изображения было выполнено через 12 часов воздействия. Белковый профиль штамма WT содержал значительное количество радиоактивно меченного аргинина, что указывает на то, что бактерии использовали цитозольный пул аргинина хозяина для своей собственной трансляции.Однако штамм Δ argT не включал радиоактивно меченый аргинин хозяина (фиг. 4B, верхняя панель). Комплементарный штамм argT показал профиль белка, подобный штамму WT. Равную загрузку белков подтверждали вестерн-блоттингом белка фактора рециклинга рибосом (RRF) Salmonella (фиг. 4B, средняя панель). Контаминация белка-хозяина была исключена путем проведения вестерн-блоттинга на β-актин). Данные, представленные на фиг. 4B, нижняя панель показывают, что белок-хозяин эффективно удаляется из образцов, поскольку только в положительном контроле лизата BMDM имеется полоса β-актина.

Рисунок 4. Salmonella используют аргинин хозяина для синтеза белка.

( A ) Анализ поглощения аргинина выполняли с 10 8 номерами WT, Δ argT и argT дополненным штаммом (c- argT) на поздней стационарной фазе роста. ( B ) Верхняя панель . BMDM, поддерживаемые в DMEM без аргинина, были инфицированы либо WT, Δ argT , либо штаммом, дополненным argT (c- argT) .Через 25 мин заражения к клеткам добавляли меченый радиоактивным изотопом аргинин. После 12 ч инфицирования равные количества выделенных бактериальных белков из 10 9 бактерий были загружены на страницу SDS. Гель выдерживали в кассете в течение 12 часов, и включенную радиоактивность оценивали сканированием фосфорного формирователя изображения. Средняя панель , Равная загрузка бактерий во всех образцах была подтверждена проведением вестерн-блоттинга против фактора рециркуляции рибосом (RRF). Нижняя панель , Клеточное загрязнение в образцах проверяли с помощью вестерн-блоттинга β-актина.В положительном контроле с лизатом BMDM наблюдалась только специфическая полоса для актина. Статистическая значимость была определена следующим образом: **, P <0,01, **, P <0,01 (критерий Стьюдента t ).

https://doi.org/10.1371/journal.pone.0015466.g004

ArgT является важным детерминантом вирулентности

Мы подозревали, что неспособность использовать цитозольный аргинин хозяина может препятствовать выживанию Δ argT Salmonella внутри макрофагов.В соответствии с нашей гипотезой, у BMDM кратность репликации WT была 9-кратной от 2 до 12 часов, тогда как кратность репликации штамма Δ argT была только 3-кратной. Штамм c-argT рос так же, как и штаммы WT (фиг. 5A). Затем мы исследовали роль argT в выживании Salmonella in vivo . После заражения мышей BALB / c штаммом WT или штаммом Δ argT мы проанализировали бактериальную нагрузку в селезенке и печени.После 5 дней инфицирования бактериальная нагрузка штамма Δ argT была значительно меньше в селезенке и печени по сравнению со штаммом WT (рис. 5B – C). Бактериальная нагрузка штамма c- argT была почти равна штамму WT ​​в селезенке. Однако в печени штамм c- argT не рос точно так же, как штамм дикого типа, но вирулентность значительно снижалась по сравнению с штаммом с нокаутом. Вместе эти данные предполагают, что argT является важной детерминантой вирулентности Salmonella .Снижение бактериальной нагрузки штамма Δ argT in vivo может быть связано с усилением NO-ответа макрофагов в случае инфекции Δ argT , а также из-за неспособности штамма Δ argT усваивать аргинин хозяина. пул для перевода.

Фигура 5. Δ argT Salmonella аттенуирована на вирулентность и демонстрирует сниженную бактериальную пролиферацию in vivo .

( A ) Анализ внутриклеточной выживаемости.BMDM были инфицированы при 10 MOI с помощью WT, Δ argT или штамма, дополненного argT (c- argT) . Инфицированные макрофаги лизировали через 2 и 16 ч после инфицирования, и количество бактерий определяли в трех повторностях. 1 × 10 6 бактерий, каждый из штаммов WT или Δ argT или штамма комплемента argT ( c-argT ), инокулировали перорально группе из 6 мышей-самцов BALB / c. После 5 -го дня инфицирования гомогенизированные образцы ( B ) селезенки, ( C ) печени инфицированных мышей помещали на чашки с антибиотиками и подсчитывали колонии.Представленный результат является одним из трех независимых экспериментов. Статистическая значимость была определена следующим образом: *, P <0,05, **, P <0,01 (критерий Манна-Уитни U ).

https://doi.org/10.1371/journal.pone.0015466.g005

Кроме того, нитритный ответ инфицированных макрофагов в случае инфекции Δ argT был значительно выше по сравнению с инфицированными клетками дикого типа (рис. 6А), указывая на то, что аргинин, доступный для синтеза NO в инфицированных Δ argT клетках, больше.В BMDM штамм argT ослаблен в 3 раза по сравнению со штаммом WT. Чтобы исключить, зависело ли это увеличение ответа NO от меньшего количества бактерий в BMDM, инфицированных Δ argT , мы провели тот же эксперимент, используя более высокий MOI 30 для штамма Δ argT . В этих условиях также клетки, инфицированные штаммом Δ argT , продуцировали повышенный уровень нитрита в супернатанте. Чтобы понять, может ли большее количество аргинина усилить ответ макрофагов на NO, мы инфицировали макрофаги сальмонеллой дикого типа при различной концентрации аргинина.Данные, представленные на фиг. 6В, показывают, что увеличение концентрации аргинина в культуральной среде с 0,5 до 1 мМ действительно усиливало реакцию NO инфицированных WT клеток макрофагов. Однако дальнейшее повышение уровня L-аргинина с 1 мМ до 2 мМ не повлияло на продукцию нитрита. Таким образом, повышенный NO-ответ макрофагов, инфицированных Δ argT Salmonella , может быть связан с большей доступностью аргинина для iNOS для синтеза NO.

Рисунок 6. Инфицирование штаммом Δ argT в BMDM вызывает высокий ответ NO.

( A ) BMDM были инфицированы при 10 MOI с WT, Δ argT или штаммом, дополненным argT (c- argT ), а также 30 MOI из Δ argT и Комбинированный штамм argT (c- argT ) штамм. Продукция нитрита определялась в культуральных супернатантах инфицированных BMDM по реакции Грисса через 12 часов после инфицирования. ( B ) BMDM поддерживали в концентрации L-аргинина 0,5, 1,0, 1,5 или 2,0 мМ и инфицировали WT Salmonella в течение 12 часов.Продукция нитрита определялась в культуральных супернатантах реакцией Грисса. Значения выражены как среднее ± стандартное отклонение одного из трех независимых экспериментов, проведенных в трех повторностях. Статистическая значимость была определена следующим образом: * P <0,05 (критерий Стьюдента t ).

https://doi.org/10.1371/journal.pone.0015466.g006

Механизм захвата цитозольного аргинина внутриклеточными

Salmonella

Затем мы исследовали механизм, с помощью которого внутриклеточный Salmonella получает доступ к цитозольному пулу аргинина хозяина.Мы проверили совместную локализацию mCAT1 с внутриклеточными Salmonella в BMDM с помощью конфокальной микроскопии. Мы наблюдали, что mCAT1 хозяина, который экспрессируется исключительно в клеточной мембране в неинфицированных макрофагах, предпочтительно рекрутируется внутриклеточной Salmonella в инфицированных BMDM. Мы продолжили проверять рекрутирование mCAT1 внутриклеточной Salmonella в различные моменты времени после заражения. Для этого мы инфицировали макрофаги WT-GFP Salmonella в разные промежутки времени (рис.7A, 8A) и наблюдали, что локализация mCAT1 в SCV начинается через 3-4 часа после инфицирования. Мы также иммуноокрашивали инфицированную клетку на LAMP1, который является маркером SCV, чтобы окончательно продемонстрировать паттерн локализации переносчиков CAT-хозяина. Мы наблюдали значительную совместную локализацию жизнеспособного WT Salmonella (зеленый) и белка mCAT1 (красный) через 4 ч (фиг. 7C) и 12 ч (фиг. 8C) инфекции, вызывая желтый цвет. Белок LAMP1 (синий) также значительно колокализуется с бактериями (зеленый) в оба момента времени, генерируя голубой цвет (рис.7B, 8B), указывая на присутствие LAMP1 в SCV. В оба момента времени 80–90% бактерий имели голубой цвет. Наши данные показывают, что белок mCAT также рекрутируется в LAMP1, содержащую вакуоль, вызывая пурпурный (данные не показаны) цвет в инфицированной клетке. Коэффективность совместной локализации общего синего (LAMP1) с красным (mCAT1), давшего начало пурпурному цвету, составляет около 26% через 4 часа заражения. Эта совместная локализация увеличивается до 57% через 12 часов заражения, что ясно указывает на тот факт, что Salmonella постоянно рекрутирует белок mCAT1 в SCV.Точно так же после инфицирования в течение 12 часов количество mCAT1 и бактериальной колокализации увеличивается по сравнению с 4-часовым заражением, что ясно указывает на то, что рекрутинг является активным. В нескольких областях было подсчитано количество бактерий, совместно локализованных с белком mCAT1. Это было сделано путем деления количества бактерий, имеющих желтые пятна, на общее количество бактерий из различных областей и нескольких экспериментов. 4 часа заражения Salmonella в BMDM позволили 35% от общего числа Salmonella приобрести mCAT1.12 ч инфицирования позволили почти 75% бактерий из общего числа внутриклеточных бактерий рекрутировать mCAT1 (рис. 8E). Наблюдали три вида совместной локализации, а именно совместную локализацию пятен, частичную совместную локализацию или полную совместную локализацию бактерий с белком mCAT1 (рис. 7C, вставки 8C). Совместная локализация LAMP1 и mCAT1 в GFP Salmonella указывает на то, что переносчики аргинина хозяина присутствуют в очень близкой вязкости с SCV. Это приводит к появлению одних и тех же бактерий, имеющих иммуноокрашивание как LAMP, так и mCAT1, и белого цвета, если все три находятся в одной и той же области.Увеличенные бактерии показаны на вставках (рис. 7D, 8D). Этот эксперимент ясно указывает на то, что переносчики аргинина хозяина рекрутируются внутриклеточными Salmonella в их вакуоли.

Рисунок 7. Внутриклеточная Salmonella начинает колокализоваться с mCAT1 хозяина в BMDM в ранний момент инфицирования.

и

BMDM были инфицированы WT Salmonella в течение 4 часов. Сайты колокализации выявляли путем иммуноокрашивания антителом против mCAT1 и вторичным антителом, конъюгированным с Cy5, а также с антителом против LAMP1 и вторичным антителом, конъюгированным с Cy3.Окрашивание Cy3 имело псевдо-синий цвет. Образцы были проанализированы с помощью конфокальной лазерной сканирующей микроскопии, и показаны репрезентативные изображения для определения местоположения BCG-GFP (зеленый), mCAT1 (красный) и LAMP1 (синий). ( A ) Репрезентативное изображение для локализации WT-GFP (зеленый) в полутоновом изображении. ( B ) Изображение для локализации WT-GFP (зеленый) и LAMP1 (синий). Колокализация дает голубой цвет. Врезка: увеличенное изображение бактерий, содержащих вакуоль.( C ) Изображение для локализации CAT1 (красный) и WT-GFP (зеленый). Колокализация дает желтый цвет. Врезка: увеличенное изображение бактерий, содержащих вакуоль. ( D ) Изображение для локализации CAT1 (красный), WT-GFP (зеленый) и LAMP1 (синий). Совместная локализация LAMP1 и mCAT1 в GFP Salmonella дает начало тем же бактериям, имеющим иммуноокрашивание как LAMP, так и mCAT1, увеличенные бактерии показаны на вставках.

https: // doi.org / 10.1371 / journal.pone.0015466.g007

Рис. 8. Внутриклеточная Salmonella колокализуется с mCAT1 хозяина в BMDM в поздний момент инфицирования.

и

BMDM инфицировали WT Salmonella в течение 12 часов и окрашивали, как описано ранее. ( A ) Репрезентативное изображение для локализации WT-GFP (зеленый) в полутоновом изображении. ( B ) Изображение для локализации WT-GFP (зеленый) и LAMP1 (синий). Колокализация дает голубой цвет.Врезка: увеличенное изображение бактерий, содержащих вакуоль. ( C ) Изображение для локализации CAT1 (красный) и WT-GFP (зеленый). Колокализация дает желтый цвет. Врезка: увеличенное изображение бактерий, содержащих вакуоль. ( D ) Изображение для локализации CAT1 (красный), WT-GFP (зеленый) и LAMP1 (синий). Это дает начало тем же бактериям, имеющим иммуноокрашивание как LAMP, так и mCAT1, увеличенные бактерии показаны на вставках. Колокализация трех цветов дает белый цвет.( E ) Процент совместной локализации WT Salmonella с mCAT1 через 4 (белая полоса) и 12 ч (черная полоса) после заражения. Совместная локализация (%) WT-GFP Salmonella с mCAT1 наносится на график после подсчета из 50 полей в трех независимых экспериментах. Из общего числа бактерий в этих полях подсчитывали количество желтых бактерий и наносили на график совместную локализацию (%). Также показано количество LAMP1, совместно локализованного с белком mCAT1. Для этой цели подсчитывалась эффективность совместной локализации синего, который совместно локализовался с красным и давал пурпурный цвет.Статистическая значимость была проверена путем сравнения значений 4 часов со значениями 12 часов, определенными следующим образом: * P <0,05 (критерий Стьюдента t ).

https://doi.org/10.1371/journal.pone.0015466.g008

Чтобы лучше понять, используется ли этот механизм другими внутриклеточными бактериями, мы проверили колокализацию mCAT1 во внутриклеточную Mycobacterium bovis BCG. Интересно, что в BMDM, инфицированных M. bovis BCG, также было обнаружено, что mCAT1 значительно колокализуется с внутриклеточной BCG (рис.9А). Напротив, никаких признаков колокализации не было отмечено для погибших от тепла мертвых Salmonella в BMDM через 12 часов инфекции (рис. 9B), что ясно указывает на то, что привлечение mCAT1 является стратегией выживания живой и вирулентной Salmonella и не зависит от Salmonella LPS. BMDM, инфицированные непатогенной кишечной палочкой , показали значительно меньшую колокализацию с mCAT1, что указывает на то, что это рекрутирование является стратегией вирулентности патогенных бактерий (рис.9C). Латексные шарики GFP также показали резко сниженный образец совместной локализации (фиг. 9D). В случае Mycobacteria инфицированных клеток 70% бактерий из общего числа бактерий, подсчитанных во многих областях, совместно с белком mCAT1, в то время как тепло убило Salmonella , E.coli или клетки, содержащие бусинки, имели только 10–20% бактерий. общее количество бактерий или шарик, совместно локализованный с белком mCAT1 (фиг. 9E).

Рисунок 9. Характер распределения mCAT1 в BMDM после инфицирования различными другими патогенами или состояниями.

( A ) Внутриклеточный M. bovis BCG (GFP) колокализуется с белком mCAT1 хозяина в BMDM через 12 часов после инфицирования. Сайты колокализации выявляли путем иммуноокрашивания антителом против mCAT1 и вторичным антителом, конъюгированным с Cy5. Образцы были проанализированы с помощью конфокальной лазерной сканирующей микроскопии, и показаны репрезентативные изображения для определения местоположения BCG-GFP (зеленый) и mCAT1 (красный). Врезка: увеличенное изображение области, содержащей бактерии. ( B ) Убитый нагреванием Salmonella (GFP) через 12 часов заражения BMDM показан зеленым, а mCAT1 показан красным.Окрашивание производили, как описано ранее. ( C ) BMDMS инфицировали штаммом dh5a E.coli (GFP) при MOI 10 в течение 12 ч и окрашивали, как описано ранее. ( D ) BMDM позволяли фагоцитировать инертные латексные шарики (GFP, соотношение 1-25) и фиксировали через 12 часов после фагоцитоза. Окрашивание производили, как описано ранее. ( E ) Процент совместной локализации BCG, убитых нагреванием Salmonella (HK), E.coli или гранул GFP (Beads) с mCAT1 наносят на график после подсчета из 50 полей в трех независимых экспериментах.Из общего количества бактерий / гранул в этих полях подсчитывали общее количество желтых бактерий / гранул, наносили на график совместную локализацию (%) и проверяли значимость после сравнения любой группы со значениями совместной локализации GFP-гранул. Статистическая значимость была определена следующим образом: * P <0,05 (критерий Стьюдента t ).

https://doi.org/10.1371/journal.pone.0015466.g009

Обсуждение

Аргинин является важным регулятором врожденного иммунного ответа хозяина [5], [6].Есть два основных транспортера аргинина в клетках млекопитающих [8], и сообщалось, что из них mCAT2B необходим для устойчивого производства NO в макрофагах [19]. Опубликованные отчеты предполагают, что лечение LPS и IFNγ [20] или другое патогенное вмешательство [21] может увеличивать экспрессию транспортеров аргинина mCAT1 и mCAT2B. Предыдущие исследования показали, что выживаемость M. bovis [22], Taxoplasma [23], Trypanosoma [24] и Leishmania [25], [26] внутри макрофагов зависит от их способности вмешиваться. с метаболическим путем аргинина хозяина.Мы предположили, что внутриклеточная Salmonella может использовать цитозольный аргинин хозяина для экономии собственных затрат энергии. Кроме того, нас в основном интересовал транспорт аргинина, поскольку эта аминокислота является единственным субстратом для выработки NO хозяином, который, в свою очередь, может убить патогенную Salmonella . Мы показали, что после 12 часов заражения Salmonella в BMDM мРНК mCAT1 и mCAT2B, а также захват аргинина были значительно повышены по сравнению с неинфицированными клетками.Клетки печени и селезенки мышей, инфицированных Salmonella , также показали повышенное поглощение аргинина. Мы также наблюдали, что даже в дендритных клетках Salmonella инфекция приводила к увеличению поглощения аргинина.

Мы предположили, что внутриклеточная Salmonella может получить доступ к цитозольному пулу аргинина хозяина путем рекрутирования переносчика аргинина с клеточной мембраны на мембрану SCV. Наши конфокальные данные ясно продемонстрировали, что внутриклеточная Salmonella рекрутирует переносчик аргинина хозяина mCAT1 к бактериям, содержащим вакуоль.Находясь в инфицированных клетках, мы иммуноокрашивали на mCAT1 и LAMP1. Сразу после инвазии особи Salmonella обнаруживаются в дискретных вакуолях, характеризующихся временным присутствием ранних эндоцитарных маркеров на мембране [27]. Через 5-10 минут после инвазии эти белки заменяются ассоциированными с лизосомами мембранными белками (LAMP), которые накапливаются дальше в течение многих часов [28]. LAMP1 является известным маркером SCV [29], и наши данные показали, что более 90% всех бактерий были колокализованы с LAMP1.Мы также наблюдали, что белок mCAT1 рекрутируется в SCV. Через 4 часа после заражения около 35% всех бактерий колокализуются с mCAT1. В поздний момент заражения этот процент увеличивается до 75%, что указывает на то, что этот процесс вербовки является активным. Мы также наблюдали, что белок mCAT1 и LAMP1 находятся в непосредственной близости в инфицированной клетке, и совместная локализация активно увеличивается с инфекцией. С одной стороны, совместная локализация mCAT1 с бактериями, а с другой стороны, совместная локализация mCAT1 с ранее известным маркером SCV LAMP1 ясно указывает на тот факт, что переносчики аргинина хозяина рекрутируются в SCV.Это дает начало тем же бактериям, имеющим иммуноокрашивание как на LAMP, так и на mCAT1. Интересно, что это рекрутирование mCAT1 не проявляется убитыми нагреванием Salmonella или непатогенными E.coli или латексными шариками. Таким образом, измененный транспорт mCAT1, по-видимому, является активным процессом, опосредованным живыми патогенными бактериями, и не зависит от LPS. Данные, представленные на рис. 7–9, ясно показывают, что в случае Bead E.coli или убитые нагреванием бактерии инфицировали BMDM; mCAT1 хозяина локализован на мембране.Однако в случае заражения Salmonella наблюдается четкое перераспределение. В инфицированной клетке мембрана, а также SCV содержат значительное количество переносчика аргинина хозяина. Тот факт, что подобный фенотип наблюдался с внутриклеточным M. bovis BCG, увеличивает важность этого нового открытия. Поскольку предыдущие исследования показали, что в случае инфекции БЦЖ наблюдается явное увеличение поглощения аргинина хозяином и уровня экспрессии переносчиков аргинина хозяином.Кроме того, роль гена M. bovis BCG, gabP хорошо известна в поглощении аргинина хозяина внутриклеточной BCG [12]. Наше исследование предоставляет первое свидетельство того, что переносчик аргинина хозяина mCAT1 действительно задействован во внутриклеточной БЦЖ. Мы хотели проверить, участвует ли CAT2B в SCV после заражения Salmonella . Однако из-за отсутствия коммерческих антител мы не смогли провести конфокальные исследования. Чтобы преодолеть эту проблему, мы сконструировали конструкцию кДНК-GFP мышиного гена CAT2B и трансфицировали в BMDM.Мы наблюдали совместную локализацию белка GFP с SCV после заражения Salmonella , что указывает на то, что CAT2B также играет важную роль в передаче аргинина хозяина бактериям (данные не показаны). Однако из-за слияния белка GFP с мембранным транспортером CAT2B возникла проблема в свойстве белка перекрывать мембрану. Мы наблюдали диффузный паттерн экспрессии конструкции CAT2B :: GFP по всей клетке.

Мы также предположили, что внутривакуолярный Salmonella использует свой эндогенный транспортер аргинина для транспортировки аргинина из цитозоля хозяина внутрь SCV.В соответствии с нашей гипотезой, мы наблюдали очень важную роль периплазматического связывающего белка аргинина, ArgT, в патогенезе Salmonella . Было обнаружено, что белок ArgT активируется при инфицировании BMDM, что указывает на его роль во внутриклеточном выживании Salmonella. Как отмечалось ранее [30], мы также обнаружили, что этот белок не подвергается сильной активации при инфекции, поскольку этот ген также играет роль в выживании in vitro. Нокаут argT Salmonella был значительно ослаблен в BMDM и на мышиной модели инфекции, что позволяет предположить тот факт, что ArgT является основным переносчиком аргинина в Salmonella , необходимым для приобретения аргинина хозяина, и является важным маркером вирулентности.При инфицировании Δ argT в BMDM ответ NO хозяина был значительно выше по сравнению с Salmonella дикого типа , что позволяет предположить, что этот транспорт также является механизмом снижения продукции NO хозяином путем секвестрации аргинина с пути iNOS. Чтобы еще больше проверить этот момент, мы добавили возрастающее количество L-аргинина во время инфицирования BMDMs сальмонеллой WT . Как наблюдалось ранее [31], продукция NO из инфицированных макрофагов значительно увеличивалась после изменения концентрации L-аргинина с 0.От 5 до 1 мМ. Дальнейшее увеличение концентрации L-аргинина не оказало дополнительного влияния на продукцию NO, поскольку концентрация субстрата для iNOS могла достигнуть предела насыщения. Чтобы изучить судьбу аргинина хозяина в патогенезе Salmonella , мы проследили включение радиоактивно меченного аргинина хозяина в организм дикого типа и Δ argT Salmonella . Фосфорный имидж-сканер показал, что Salmonella дикого типа использует радиоактивно меченый аргинин хозяина для синтеза собственного белка. Δ argT Salmonella не смог использовать аргинин хозяина для своей трансляции.Насколько нам известно, это исследование впервые продемонстрировало, что внутриклеточная Salmonella использует аргинин хозяина для выживания в антигенпредставляющих клетках, таких как BMDM и DC. Интересно, что это поглощение аргинина хозяина внутриклеточной Salmonella может быть использовано для специфической доставки меченных аргинином антибиотиков к патогену, обеспечивая лучшее уничтожение. Несомненно, клетка-хозяин увеличивает поглощение аргинина в ответ на ЛПС во время инфекции Salmonella , чтобы увеличить активность iNOS и продукцию NO для контроля патогена.Однако Salmonella подрывает этот защитный механизм хозяина и использует этот дополнительный аргинин для своей собственной трансляции.

В заключение, увеличение переносчиков аргинина хозяином в ответ на инфекцию Salmonella является механизмом врожденного иммунитета, первоначально предназначенным для увеличения продукции NO хозяином. Однако наши данные свидетельствуют о том, что этот врожденный иммунный ответ, направленный на борьбу с инфекцией, используется патогеном для его собственной трансляции. Вкратце, инфекция Salmonella увеличивает переносчики аргинина, и переносчики локализуются в SCV.Все эти механизмы приводят к поглощению аргинина бактериями. Таким образом, Salmonella активирует переносчики аргинина хозяина и использует дополнительный аргинин. Таким образом, Salmonella подавляет аргинин от пути iNOS. Кроме того, бактерии получают аргинин для собственного синтеза белка без дополнительных затрат. Энергетическое преимущество этой патогенной стратегии предполагает, что, возможно, могут быть и другие переносчики аминокислот, которые также активируются.Однако мы не обсуждали их здесь, поскольку они выходят за рамки наших исследований. Лучшее понимание потребности патогена в питательных веществах даст важные ключи к дальнейшему пониманию этого вопроса. Выяснение эффекторов Salmonella , вовлеченных в измененный трафик переносчиков аргинина хозяина, требует дальнейших исследований. Наши данные показывают, что меченый аргинином антибиотик может способствовать специфической и направленной доставке любого антибиотика к внутриклеточным Salmonella и Mycobacteria , обеспечивая лучшее уничтожение.В инфицированной клетке меченый аргинином антибиотик может достигать патогена, содержащего вакуоль, посредством перемещенных переносчиков аргинина хозяина и может оказаться очень эффективным.

Материалы и методы

Заявление об этике

Вся работа с животными проводилась в соответствии с утвержденным Институтом этическим протоколом. Номер этики CAF / ETHICS / 189/2010.

Бактериальные штаммы, среды и условия роста

Устойчивый к налидиксовой кислоте дикий тип (WT) S.enterica серовар Typhimurium штамм 12023 использовали в качестве родительского штамма для конструирования нокаута и для всех других экспериментов (подарен профессором М. Хензелем, Германия). Он вирулентен на мышиной модели инфекции. Культуру дикого типа выращивали при 37 ° C в бульоне Луриа в налидиксовой кислоте (50 мкг / мл), Δ argT Salmonella в канамицине (50 мкг / мл) и дополняли штамм Δ argT в ампициллине (50 мкг / мл). мл). Убитый нагреванием Salmonella получали нагреванием бактериальной культуры при 80 ° C в течение 20 минут.

Получение макрофагов из костного мозга (BMDM)

Как описано ранее [32], бедренные кости собирали у мышей в асептических условиях и промывали костный мозг. Клетки поддерживали в среде DMEM с добавлением 30% среды, кондиционированной клетками L929, 10% инактивированного нагреванием FBS, 2 мМ l-глутамина, 100 Ед / мл пенициллина и 100 мкг / мл стрептомицина. При анализе сортировки клеток с активацией флуоресценции наблюдалось, что клетки были> 90% CD11b-положительными. Линия клеток L929 была любезным подарком проф.M.S.Shaila, Отдел микробиологии, Индийский институт науки, Бангалор, Индия.

Культура клеток и бактериальная инфекция

Клетки

поддерживали в инкубаторе при 37 ° C с 5% CO 2 в среде Игла, модифицированной Дульбекко (DMEM, Sigma), с добавлением 10% инактивированной нагреванием фетальной телячьей сыворотки (Sigma). Как описано ранее [33], штаммы Salmonella были добавлены к клеткам макрофагов, растущим в 24-луночных планшетах для культивирования тканей при множественности инфицирования (MOI) 10.Бактерии центрифугировали на клетках при 500 × g в течение 10 мин. После инфицирования в течение 25 мин клетки трижды промывали PBS и инкубировали в течение 1 ч в среде для культивирования клеток, содержащей 50 мкг / мл гентамицина (Sigma). Среду заменяли средой, содержащей гентамицин с концентрацией 10 мкг / мл, до конца эксперимента. В другой серии экспериментов клетки были истощены по аргинину путем культивирования в среде без аргинина (Hi-media) в течение 72 часов и использовались для последующих исследований с добавлением 14 C-L-аргинина (BARC, Индия, 0.1 мКи / мл).

Для подсчета внутриклеточных бактерий макрофаги трижды промывали PBS и лизировали 0,1% Triton X-100 в течение 10 мин, и серийные разведения наносили на чашки с агаром LB.

Mycobacterium bovis Инфекция БЦЖ

M. bovis BCG Pasteur 1173P2 выращивали до средней логарифмической фазы в среде Сутона. Пакетные культуры разделяли на аликвоты и хранили при -70 ° C. Типичные флаконы размораживали и подсчитывали количество жизнеспособных колониеобразующих единиц на агаре Миддлбрук 7h20 (Difco) с добавлением OADC (олеиновая кислота, альбумин, декстроза, каталаза).Одноклеточные суспензии бактерий получали с помощью коротких импульсов обработки ультразвуком. Бактерии использовали при 10 MOI для инфекции, как описано ранее [34].

Определение концентрации нитрита

Накопление нитрита

(NO 2 -) в супернатантах культивируемых макрофагов использовали в качестве индикатора продукции NO и измеряли реакцией Грисса с нитритом натрия в качестве стандарта для расчета количества продуцируемого нитрита. 50 мкл супернатанта инкубировали с 50 мкл раствора, содержащего дигидрохлорид N- [нафтил] этилендиамина (NED) (0.01%) и 50 мкл раствора, содержащего сульфаниламид (0,1%) в 5% фосфорной кислоте, в течение 10 мин. Затем измеряли оптическую плотность при 540 нм.

Полуколичественная ОТ-ПЦР

BMDM засевали в количестве 1 × 10 6 на лунку в шестилуночные планшеты и инфицировали при 10 MOI бактериями WT. Через 12 ч заражения суммарную РНК выделяли с помощью реагента TRIzol (Sigma). Впоследствии 2 мкг РНК из каждого образца подвергали обратной транскрипции с использованием «набора PROMEGA RT». Один цикл ПЦР состоял из следующего: 94 ° C в течение 1 мин, 60 ° C в течение 1.5 мин и 72 ° C в течение 2 мин. Для mCAT1 использовали следующие праймеры: прямой, 5'-caa caa tag gac caa aac acc c-3 'и обратный, 5'-cga aga tgc tca aga cag gaa g-3'. Для mCAT2B использовали следующие праймеры: прямой, 5'-tca att cca aaa cga aga cac cag ta - 3 'и обратный, 5'-ag tca aaa aga aag gcc atc aca-3'. Аналогичным образом, для β-актина мыши : прямого, 5'-tgg aat cct gtg gca tcc a-3 'и обратного использовали праймеры 5'-taa cag tcc gcc tag aag ca-3'.

Анализ поглощения аргинина в BMDM

Поглощение

аргинина измеряли у неинфицированных BMDM и у инфицированных Salmonella при MOI 10, как описано ранее [12].Вкратце, через 12 часов заражения проводили две начальные промывки 500 мкл предварительно нагретого поглощающего раствора (137 мМ NaCl, 5,4 мМ KCl, 1,2 мМ MgSO 4 .7H 2 O, 2,8 мМ CaCl 2 .2H. 2 O, 10 мМ HEPES и 1 мМ KH 2 PO 4 , pH 7,4). Поглощение аргинина начинали добавлением 250 мкл 100 мкМ L- [ 14 C (U)] аргинина (0,1 мКи / мл, BARC, Индия) в предварительно нагретом буфере для захвата, содержащем 5 мМ L-лейцина, в течение 10 мин в культуре ткани. инкубатор в 10% CO 2 при 37 ° C.Реакцию останавливали, удаляя радиоактивный аргинин и трижды промывая стоп-раствором (10 мМ HEPES, 10 мМ Трис, 137 мМ NaCl и 10 мМ нерадиоактивный аргинин [pH 7,4]) для удаления невключенных субстратов. Затем клетки лизировали 1% додецилсульфатом натрия и радиоактивное включение определяли с помощью жидкостного сцинтилляционного анализатора. Концентрации белка измеряли с помощью реагентов Брэдфорда. Количество включенного аргинина на образец нормализовали к общей концентрации белка в каждом образце.

Конструирование штамма

Salmonella , экспрессирующего хромосомный слитый белок ArgT :: 6xHis

Штамм Salmonella , экспрессирующий слитый белок ArgT :: 6xHis, был сконструирован в сероваре Typhimurium модифицированным методом одностадийной стратегии делеции, как описано Даценко [35]. Вкратце, трансформанты серовара Typhimurium, несущие красную вспомогательную плазмиду (pKD46), выращивали в LB с ампициллином и 10 мМ L-арабинозы при 30 ° C до OD (600 нм) 0.35–0,4, а затем сделали его электрокомпетентным путем трехкратной промывки ледяной 10% глицерином и водой MilliQ. В этой стратегии праймер для прямого нокаута был модифицирован, чтобы нести 5'6-кодирующие последовательности гистидина. Этот праймер, содержащий гистидиновую метку, был направлен против области непосредственно ниже гена argT (включая стоп-кодон argT ). Набор праймеров для нокаута эффективно нокаутировал ген размером 1 т.п.н. (STM2356) ниже argT , одновременно маркируя argT на его С-конце 6 последовательностями, кодирующими гистидин.За ним следовал другой стоп-кодон, чтобы получить только слитый белок ArgT :: 6xHis.

Был получен продукт ПЦР

, содержащий ген устойчивости к хлорамфениколу (из плазмиды pKD3), фланкированный последовательностями выше и ниже гена argT . Были использованы следующие праймеры: прямой, 5′caaaaagtacttcgattttaatgtttacggcgatcatcaccatcaccatcactga catatgaatatcctccttag 3 ′ и обратный, 5 ′ caaaaagtacttcgattttaatgtttacggcgatcatcaccatcaccatatcactc ′catctgaatga. Затем эту ДНК электропорировали в Salmonella Typhimurium, несущую pKD46.Мутанты были отобраны по устойчивости к хлорамфениколу и подтверждены ПЦР с использованием следующих подтверждающих праймеров. Для подтверждения использовали следующие праймеры: прямой, 5'-cctcacatcacgccggat -3 'и обратный, 5'-cgaaggtttcctgaagcag -3'. В штамме knock in была амплифицирована полоса размером 1 т.п.н., соответствующая кассете хлорамфеникола, тогда как в штамме WT наблюдалась полоса размером 1,2 т.п.н., соответствующая следующему гену гена argT (STM2356). Мы также подтвердили хромосомный удар в штамме, лизируя бактерии и затем выполняя вестерн-блоттинг против His, и наблюдали одиночную полосу 27 кДа, соответствующую слитому белку ArgT :: 6xHis.

Экспрессия белка ArgT

Для этой цели использовали штамм Salmonella , экспрессирующий слитый белок ArgT :: 6xHis. Штамм Salmonella дикого типа использовали в качестве контроля. Оба штамма инокулировали в бульон LB, и BMDM инфицировали отдельно каждым штаммом. Из инфицированных клеток очищали бактерии и равное количество общего белка загружали в 15% SDS PAGE. Бактериальный лизат, выращенный LB, также загружали в тот же гель, что и контроль.Белки переносили на нитроцеллюлозную мембрану и проводили вестерн-блоттинг против His с конъюгированным с HRP анти-His антителом (1-20000, Sigma). Контролем загрузки служил фактор рециклинга рибосом (RRF) и антитело против RRF (любезный подарок профессора Умеша Вершни, Индийский институт науки, Индия. Polyclonal, 1-2000). Мы могли эффективно наблюдать уровень экспрессии белка ArgT :: 6x His в инфицированных клетках. Кроме того, изменение экспрессии ArgT :: 6x His также отслеживали, когда бактерии переходили из LB во внутриклеточное состояние.

Конструирование E. coli :: штамм GFP

Штамм E. coli DH5α был сделан компетентным с помощью метода CaCl2, а плазмида GFP была трансформирована методом теплового шока. Полученные колонии отбирали в планшетах с ампициллином, присутствие плазмиды подтверждали перевариванием, а экспрессию GFP проверяли с помощью флуоресцентной микроскопии.

Конструирование штаммов мутанта

argT argT) Salmonella

Мутация argT (STM 2355) была сконструирована в сероваре Typhimurium в соответствии с одностадийной стратегией делеции, описанной Даценко [35].Вкратце, трансформанты серовара Typhimurium, несущие красную вспомогательную плазмиду (pKD46), выращивали в LB с ампициллином и 10 мМ L-арабинозы при 30 ° C до OD (600 нм) 0,35–0,4, а затем делали электрокомпетентным путем трехкратной промывки водой. ледяной 10% глицерин и вода MilliQ. Был получен продукт ПЦР, содержащий ген устойчивости к канамицину (из плазмиды pKD4), фланкированный последовательностями выше и ниже гена argT . Для argT были использованы следующие праймеры: прямой, 5'-acc gtg ata gtt ccc cag cgc ggc gcg tta tcc cct tcc cgt gta ggc tgg agc tgc t-3 'и обратный, 5'-cac aca acg cca cgt aaa aca taa gaa aat gac gcc act tca tat gaa tat cct cct tag-3 '.Затем эту ДНК электропорировали в Salmonella Typhimurium, несущую pKD46. Мутанты были отобраны по устойчивости к канамицину и подтверждены ПЦР с использованием следующих подтверждающих праймеров. Для argT использовали следующие праймеры: прямой, 5'-ctg ttc cgc aac ggc tta tg-3 'и обратный, 5'-cga atc ​​gtt ttg ctg acg tg-3'. В нокаутном штамме была амплифицирована полоса 1,5 т.п.н., соответствующая кассете канамицина, тогда как в штамме WT наблюдалась полоса 782 п.о., соответствующая гену argT .Другой набор праймеров использовали для подтверждения нокаутного штамма, в котором использовали внутренний обратный праймер канамицина и генно-специфический прямой праймер. В нокаутном штамме наблюдалась полоса 750 п.н., а в штамме WT полосы не было видно. Последовательность обратного праймера была 5'cagaccgttcagctggat 3 ', а прямого праймера была 5'-ctg ttc cgc aac ggc tta tg-3'. Кроме того, был использован еще один набор олигонуклеотидов (которые позже были использованы для клонирования), где прямой праймер охватывает 5 ', а обратный праймер охватывает 3' область гена argT .Олиго представляли собой прямой 5 'atgcggatccatgaagaccgttctcgc 3' и обратный 5 'atgcaagctttcaatcgccgtaaacattaa 3'. Эти праймеры давали полосу 750 п.н. в штамме WT и не давали полосы в штамме нокаутов.

Конструирование дополненного Δ

argT (c- Δ argT ) штамм Salmonella ДНК

, экстрагированную из WT Salmonella , использовали в качестве матрицы для амплификации гена argT с использованием прямого праймера 5 'atgcggatccatgaagaagaccgttctcgc 3' и обратного праймера 5 'atgcaagctttcaatcgccgtaaacattaa 3'.Амплифицированный продукт очищали, и вставки вместе с вектором pQE60 расщепляли Bamh2 и HindIII. Вектор и вставку смешивали при 1-3 молярных концентрациях и лигировали при 16 ° C в течение 16 часов. Затем содержащие вектор вставки трансформировали в компетентные клетки Escherichia coli и высевали на планшеты с LB-карбенциллином после 1 ч инкубации в среде SOC. Колонии подвергали скринингу на плазмиду, имеющую вставку, путем рестрикционного переваривания, и очищенную плазмиду, содержащую argT , затем трансформировали в электрокомпетентные клетки Δ argT .

In vivo Анализ поглощения аргинина

Для определения поглощения аргинина in vivo через 5 дней после инфицирования в асептических условиях отбирали печень и селезенку у контрольных или инфицированных мышей. Затем органы механически измельчали ​​до суспензий отдельных клеток и растворяли в 1 мл PBS. Подсчитывали каждую клеточную суспензию, отбирали 1 × 10 6 клеток и помещали в 24-луночные планшеты для тканевых культур непосредственно перед использованием в эксперименте. Поглощение аргинина измеряли аналогично описанному выше.

In vitro Salmonella Анализ поглощения аргинина

Ночью выращенные культуры штаммов WT и Δ argT Salmonella субкультивировали и выращивали в LB до стационарной фазы при 37 ° C с постоянным встряхиванием при 115 об / мин. Плотность клеток при 600 нм измеряли с помощью спектрофотометра и брали равные аликвоты OD двух штаммов для определения способности каждого штамма к поглощению аргинина. 1 × 10 8 бактерий отбирали для каждого образца и дважды промывали 500 мкл предварительно нагретого раствора для поглощения и дополнительно обрабатывали для анализа поглощения аргинина, как описано выше.Для каждого образца количество включенного аргинина было нормализовано к общему бактериальному белку.

Оценка включения аргинина хозяина во внутриклеточную

Salmonella

BMDM, поддерживаемые в DMEM, не содержащей аргинина, были инфицированы штаммом WT или Δ argT . Через 25 мин заражения к клеткам добавляли меченый радиоактивным изотопом аргинин. Через 12 часов заражения внутриклеточные бактерии выделяли из инфицированных макрофагов, как описано ранее [30], [36].Через 12 часов после заражения клетки лизировали на льду, инкубируя в течение 30 минут в 0,1% SDS, 1% кислом феноле и 19% этаноле в воде. Salmonella выделяли из лизата центрифугированием, и общий белок лизировали с использованием раствора для лизиса бактериального белка. В каждом случае бактерии выделяли из шестилуночного планшета с инфицированными клетками и объединяли для выделения белка. Бактерии помещали в чашки с антибиотиками для подсчета количества бактерий, присутствующих в различных штаммах.После получения данных КОЕ количество бактерий было нормализовано для различных образцов, и дублированные лунки были использованы для дальнейших экспериментов, и равные количества бактериальных белков после лизирования 10 9 бактерий были загружены в SDS PAGE. Гель экспонировали в кассете, и включенную радиоактивность в бактериальный лизат оценивали, выполняя сканирование с помощью фосфорного формирователя изображения (Fujifilm FLA-5100). Равное количество образцов загружали в другой гель и с положительным контролем лизата BMDM, и после переноса мембрану зондировали антителом против RRF и антителом против актина.

Инфекция мышей

Мышей BALB / c в возрасте от шести до восьми недель (Central Animal Facility, Индийский институт науки, Бангалор, Индия) содержали в условиях, свободных от специфических патогенов. Все процедуры с животными проводились в соответствии с протоколами, утвержденными учреждением. Бактериальные штаммы выращивали в условиях встряхивания в течение ночи при 37 ° C, центрифугировали, промывали и ресуспендировали до подходящей концентрации в стерильном PBS и вводили в количестве 1 × 10 7 КОЕ / мышь.Для эксперимента по инфильтрации органов через 5 дней после инфицирования в асептических условиях были взяты печень и селезенка. Органы взвешивали и гомогенизировали в 1 мл PBS. Гомогенат центрифугировали и высевали при различном разведении для определения количества бактерий.

Конфокальные эксперименты

Инфицированные клетки отмывали от среды и фиксировали в течение 10 мин в параформальдегиде (3,5%). Латексные шарики, модифицированные карбоксилатом, флуоресцентно-желто-зеленый (Sigma) добавляли к клеткам в соотношении 25-1.Затем фиксированные клетки инкубировали с кроличьими антителами против mCAT1 (Santacruz), разведенными в соотношении 1-50, и / или мышиными антителами против mLAMP1 (Dianova) в течение 1 ч в PBS, содержащем 2% BSA, 2% козьей сыворотки и 0,2% сапонина. После этого проводили инкубацию с козьим антителом против кроличьего IgG, конъюгированным с Cy5 (лаборатория Джексона, 1-100), и / или козьим антителом против мышиного IgG, конъюгированным с Cy3 (лаборатория Джексона, 1-100) в течение 1 часа. Образцы просматривали на конфокальном лазерно-сканирующем микроскопе с аргоновым лазером (Zeiss, Германия).

Статистический анализ и программное обеспечение

Каждый анализ повторяли не менее 3 раз.Данные in vitro анализировали с помощью парного t-критерия (два образца, равная дисперсия). Результаты исследований заражения in vivo на мышах оценивали с использованием U-тестов Манна-Уитни из программного обеспечения GraphPad Prism 4.0. Различия между наборами считались значимыми при P <0,05. Иммуноблоты количественно оценивали с использованием программного обеспечения Multi Gauge V2.3.

Благодарности

Мы благодарим Шридхара Шри за помощь в экспериментах с фосфорным формирователем изображения и Судхагара В. для исследований в области биоинформатики.Мы хотели бы поблагодарить Арнаб Чайну и Лахшью Катарию за полезные обсуждения. Компания Central Animal Facility (CAF) также признательна за предоставление мышей.

Вклад авторов

Задумал и разработал эксперименты: PD Amit Lahiri DC KNB. Выполнял опыты: П.Д. Амит Лахири, Н.И., Н.К., МС, Аян Лахири. Анализировал данные: PD Amit Lahiri DC. Предоставленные реагенты / материалы / инструменты анализа: DC KNB. Написал статью: Амит Лахири, округ Колумбия.

Ссылки

  1. 1.Reeves MW, Evins GM, Heiba ​​AA, Plikaytis BD, Farmer JJ 3rd (1989) Клональная природа Salmonella typhi и ее генетическое родство с другими сальмонеллами, как показано с помощью мультилокусного ферментного электрофореза и предложения Salmonella bongori comb. ноя J Clin Microbiol 27: 313–320.
  2. 2. Fields PI, Swanson RV, Haidaris CG, Heffron F (1986) Мутанты Salmonella typhimurium, которые не могут выжить в макрофагах, являются авирулентными. Proc Natl Acad Sci U S A 83: 5189–5193.
  3. 3.Chakravortty D, Hansen-Wester I, Hensel M (2002) Остров патогенности сальмонелл 2 обеспечивает защиту внутриклеточных сальмонелл от реактивных промежуточных соединений азота. J Exp Med 195: 1155–1166.
  4. 4. Дас П., Лахири А., Лахири А., Чакравортти DM Модуляция пути аргиназы в контексте микробного патогенеза: метаболический фермент, подрабатывающий в качестве иммунного модулятора. PLoS Pathog 6: e1000899.
  5. 5. Мори М., Гото Т. (2004) Ферменты метаболизма аргинина, оксид азота и инфекция.J Nutr 134: 2820S – 2825S; обсуждение 2853S.
  6. 6. Перанзони Э., Мариго I, Дольчетти Л., Угель С., Сонда Н. и др. (2007) Роль метаболизма аргинина в иммунитете и иммунопатологии. Иммунобиология 212: 795–812.
  7. 7. Стивенс Б.Р., Какуда Д.К., Ю К., Уотерс М., Во CB и др. (1996) Индуцированный синтез оксида азота зависит от индуцированного альтернативно сплайсированного CAT-2, кодирующего транспорт L-аргинина в астроцитах головного мозга. J Biol Chem 271: 24017–24022.
  8. 8.MacLeod CL (1996) Регулирование экспрессии гена переносчика катионных аминокислот (CAT). Biochem Soc Trans 24: 846–852.
  9. 9. Verrey F, Closs EI, Wagner CA, Palacin M, Endou H и др. (2004) CATs и HATs: семейство переносчиков аминокислот SLC7. Арка Пфлюгерса 447: 532–542.
  10. 10. Deves R, Boyd CA (1998) Транспортеры катионных аминокислот в клетках животных: открытие, структура и функция. Physiol Rev 78: 487–545.
  11. 11.Петерой-Келли М., Венкетараман В., Коннелл Н. Д. (2001) Влияние инфекции Mycobacterium bovis BCG на регуляцию поглощения L-аргинина и синтеза реактивных промежуточных соединений азота в макрофагах мышей J774.1. Заражение иммунной 69: 5823–5831.
  12. 12. Talaue MT, Venketaraman V, Hazbon MH, Peteroy-Kelly M, Seth A и др. (2006) Гомеостаз аргинина в макрофагах J774.1 в контексте инфекции BCG Mycobacterium bovis. J Bacteriol 188: 4830–4840.
  13. 13.Klarsfeld AD, Goossens PL, Cossart P (1994) Пять генов Listeria monocytogenes, предпочтительно экспрессируемых в инфицированных клетках млекопитающих: plcA, purH, purD, pyrE и ген-транспортер аргинина ABC, arpJ. Mol Microbiol 13: 585–597.
  14. 14. Баркер Л.П., Брукс Д.М., Смолл П.Л. (1998) Идентификация генов Mycobacterium marinum, дифференциально экспрессируемых в фагосомах макрофагов, с использованием слияния промоторов с зеленым флуоресцентным белком. Мол микробиол 29: 1167–1177.
  15. 15.Экманн Л., Лоран Ф., Лэнгфорд Т.Д., Хетско М.Л., Смит Дж. Р. и др. (2000) Производство оксида азота эпителиальными клетками кишечника человека и конкуренция за аргинин как потенциальные детерминанты защиты хозяина от патогена Giardia lamblia, обитающего в просвете просвета. J Immunol 164: 1478–1487.
  16. 16. Хиггинс CF, Эймс GF (1981) Два периплазматических транспортных белка, которые взаимодействуют с общим мембранным рецептором, демонстрируют обширную гомологию: полные нуклеотидные последовательности. Proc Natl Acad Sci U S A 78: 6038–6042.
  17. 17. Ардешир Ф., Эймс Г. Ф. (1980) Клонирование гистидиновых транспортных генов из Salmonella typhimurium и характеристика аналогичной транспортной системы у Escherichia coli. J Supramol Struct 13: 117–130.
  18. 18. Ардешир Ф., Хиггинс С.Ф., Эймс Г.Ф. (1981) Физическая карта оперона транспорта гистидина Salmonella typhimurium: корреляция с генетической картой. J Bacteriol 147: 401-409.
  19. 19. Николсон Б., Маннер С.К., Климан Дж., МакЛеод К.Л. (2001). Для устойчивого производства оксида азота в макрофагах требуется транспортер аргинина CAT2.J Biol Chem 276: 15881–15885.
  20. 20. Simmons WW, Closs EI, Cunningham JM, Smith TW, Kelly RA (1996) Цитокины и инсулин индуцируют экспрессию переносчика катионных аминокислот (CAT) в сердечных миоцитах. Регулирование транспорта L-аргинина и отсутствие продукции CAT-1, CAT-2A и CAT-2B. J Biol Chem 271: 11694–11702.
  21. 21. Ротенберг М.Э., Допкер М.П., ​​Левкович И.П., Кьярамонте М.Г., Стрингер К.Ф. и др. (2006) Катионный переносчик аминокислот 2 регулирует воспалительный гомеостаз в легких.Proc Natl Acad Sci U S A 103: 14895–14900.
  22. 22. Peteroy-Kelly MA, Venketaraman V, Talaue M, Seth A, Connell ND (2003) Модуляция метаболизма L-аргинина макрофагов J774.1 с помощью внутриклеточной BCG Mycobacterium bovis. Заражение иммунной 71: 1011–1015.
  23. 23. Томпсон Р. У., Пеше Дж. Т., Рамалингам Т., Уилсон М. С., Уайт С. и др. (2008) Катионный переносчик аминокислот-2 регулирует иммунитет, модулируя активность аргиназы. PLoS Pathog 4: e1000023.
  24. 24.Gobert AP, Daulouede S, Lepoivre M, Boucher JL, Bouteille B и др. (2000) Доступность L-аргинина модулирует местное производство оксида азота и уничтожение паразитов при экспериментальном трипаносомозе. Infect Immun 68: 4653–4657.
  25. 25. Wanasen N, MacLeod CL, Ellies LG, Soong L (2007) L-аргинин и переносчик катионных аминокислот 2B регулируют рост и выживание амастигот Leishmania amazonensis в макрофагах. Инфекция иммунной 75: 2802–2810.
  26. 26. Роджерс М., Кропф П., Чой Б.С., Диллон Р., Подиновская М. и др.(2009) Протеофософогликаны, отрыгиваемые инфицированными Leishmania москитами, нацелены на метаболизм L-аргинина в макрофагах хозяина, чтобы способствовать выживанию паразитов. PLoS Pathog 5: e1000555.
  27. 27. Холден Д.В. (2002) Торговля вакуолью Salmonella в макрофагах. Трафик 3: 161–169.
  28. 28. Баковски М.А., Браун В., Брюмелл Дж. Х. (2008) Вакуоли, содержащие сальмонеллу: направление движения и гнездование для роста. Трафик 9: 2022–2031 гг.
  29. 29. Drecktrah D, Knodler LA, Howe D, Steele-Mortimer O (2007) Торговля сальмонеллами определяется постоянными динамическими взаимодействиями с эндолизосомной системой.Трафик 8: 212–225.
  30. 30. Eriksson S, Lucchini S, Thompson A, Rhen M, Hinton JC (2003) Раскрытие биологии макрофагальной инфекции с помощью профилирования экспрессии генов внутриклеточной Salmonella enterica. Мол микробиол 47: 103–118.
  31. 31. Lahiri A, Das P, Chakravortty D (2008). Аргиназа модулирует индуцированное сальмонеллами производство оксида азота в макрофагах RAW264.7 и требуется для патогенеза сальмонелл на мышиной модели инфекции. Микробы заражают 10: 1166–1174.
  32. 32. Мундер М., Эйхманн К., Моран Дж. М., Сентено Ф., Солер Дж. И др. (1999) Th2 / Th3-регулируемая экспрессия изоформ аргиназы в мышиных макрофагах и дендритных клетках. J Immunol 163: 3771–3777.
  33. 33. Lahiri A, Das P, Chakravortty D (2008) Регулятор транскрипции LysR-типа Hrg противодействует окислительному взрыву фагоцитов и придает преимущество выживаемости серовару Typhimurium Salmonella enterica. Микробиология 154: 2837–2846.
  34. 34. Narayana Y, Balaji KN (2008) Активация и передача сигналов NOTCh2, участвующих в индуцированной Mycobacterium bovis BCG экспрессии SOCS3 в макрофагах.J Biol Chem 283: 12501–12511.
  35. 35. Даценко К.А., Ваннер Б.Л. (2000) Одностадийная инактивация хромосомных генов в Escherichia coli K-12 с использованием продуктов ПЦР. Proc Natl Acad Sci U S A 97: 6640–6645.
  36. 36. Eswarappa SM, Panguluri KK, Hensel M, Chakravortty D (2008) Оперон yejABEF сальмонелл придает устойчивость к антимикробным пептидам и способствует их вирулентности. Микробиология 154: 666–678.
.

Комментировать

Ваш адрес email не будет опубликован. Обязательные поля помечены *